Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Context-dependent gene regulation by homeodomain transcription factor complexes revealed by shape-readout deficient proteins

ABSTRACT: Eukaryotic transcription factors (TFs) form complexes with various partner proteins to recognize their genomic target sites. Yet, how the DNA sequence determines which TF complex forms at any given site is poorly understood. Here, we demonstrate that high-throughput in vitro DNA binding assays coupled with unbiased computational analysis provide unprecedented insight into how different DNA sequences select distinct compositions and configurations of homeodomain TF complexes. Using inferred knowledge about minor groove width readout, we design targeted protein mutations that destabilize homeodomain binding both in vitro and in vivo in a complex-specific manner. By performing parallel systematic evolution of ligands by exponential enrichment sequencing (SELEX-seq), chromatin immunoprecipitation sequencing (ChIP-seq), RNA sequencing (RNA-seq), and Hi-C assays, we not only classify the majority of in vivo binding events in terms of complex composition but also infer complex-specific functions by perturbing the gene regulatory network controlled by a single complex.

ORGANISM(S): Drosophila melanogaster

PROVIDER: GSE125604 | GEO | 2020/01/27

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Homeodomain-like domain of Plasmodium berghei HDP1 binds to TGCACA motif.

Project description:To investigate the DNA-binding property of homeodomain-like domain of Plasmodium berghei HDP1, DNA immunoprecipitation followed by high-throughput sequencing (DIP-seq) analysis were performed. Recombinant homeodomain-like domain fused with glutathione S-transferase were mixed with the P. berghei genomic DNA fragmented via sonication, and protein-DNA complex was harvested using glutathione-sepharose resin. The obtained DNA fragments were sequenced via the next generation sequencing.

2024-02-25 | GSE256093 | GEO

Quantitative analysis of the DNA methylation sensitivity of transcription factor complexes

Project description:EpiSELEX-seq method was used to characterize the binding preference of human TF complexes to methylated DNA, including BZIP proteins ATF4 and CEBPb, homeodomain TF heterodimers of HM(Meis1)-Pbx1 together with either HoxA1, HoxA5 or HoxA9 and tumor suppressor protein p53.

2017-06-13 | GSE98652 | GEO

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

Quantitative modeling of transcription factor binding specificities using DNA shape

2015-03-01 | GSE60200 | GEO

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-M-NM-:B as an example

Project description:We provided an improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor. We valided the strategy by characterzing the DNA-binding specificty of NF-M-NM-:B p50 dimer. Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress

Variation in homeodomain DNA-binding revealed by high-resolution analysis of sequence preferences

Project description:Most homeodomains are unique within a genome, yet many are highly conserved across vast evolutionary distances, implying strong selection on their precise DNA-binding specificities. We determined the binding preferences of the majority (168) of mouse homeodomains to all possible 8-base sequences, revealing rich and complex patterns of sequence specificity, and showing for the first time that there are at least 65 distinct homeodomain DNA-binding activities. We developed a computational system that successfully predicts binding sites for homeodomain proteins as distant from mouse as Drosophila and C. elegans, and we infer full 8-mer binding profiles for the majority of known animal homeodomains. Our results provide an unprecedented level of resolution in the analysis of this simple domain structure and suggest that variation in sequence recognition may be a factor in its functional diversity and evolutionary success. Keywords: Mouse homeodomain protein binding microarrays

2008-06-20 | GSE11239 | GEO

Context-dependent gene regulation by homeodomain transcription factor complexes revealed by shape-readout deficient proteins

Project description:Context-dependent gene regulation by homeodomain transcription factor complexes revealed by shape-readout deficient proteins

| PRJNA516909 | ENA

Differences in DNA-binding specificity of floral homeotic protein complexes predict organ-specific target genes

Project description:Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors (TFs). How these factors achieve their regulatory specificities is however still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS-domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high throughput DNA sequencing (SELEX-seq) on several floral MADS-domain protein homo- and heterodimers to measure their DNA-binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 (SEP3) and AGAMOUS (AG). Binding specificity is further modulated by different binding site (BS) spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows to differentiate between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA-binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA-binding specificity of floral MADS-domain proteins. DNA-binding specificity of individual dimers, as well as DNA-binding preferences of higher-order complexes differ between floral homeotic protein complexes. Differential DNA-binding of MADS-domain protein complexes plays a role in the specificity of target gene regulation.

2017-10-16 | GSE95730 | GEO

DNA binding analysis of rare variants in homeodomains reveals homeodomain specificity-determining residues

Project description:Homeodomains (HDs) are the second largest class of DNA binding domains (DBDs) in eukaryotic sequence-specific transcription factors (TFs) and are the TF structural class with the largest number of disease mutations in the Human Gene Mutation Database (HGMD). Despite numerous structural studies and large-scale analyses of HD DNA binding specificity, HD-DNA recognition is still not fully understood. Here, we analyzed 92 human HD mutants, including disease-associated variants and variants of unknown significance (VUS), for their effects on DNA binding activity. Many of the variants altered DNA binding affinity and/or specificity. Structural analysis identified 14 novel specificity-determining positions, 5 of which do not contact DNA. The same missense substitution at analogous positions within different HDs exhibited different effects on DNA binding activity. Variant effect prediction tools perform moderately well in distinguishing variants with altered DNA binding affinity, but poorly in identifying those with altered binding specificity. Our results highlight the need for biochemical assays of TF coding variants and promote dozens of variants for further investigations into their pathogenicity and the development of clinical diagnostics and precision therapies.

2023-12-05 | GSE233827 | GEO

Extensive characterization of NF-kappaB binding uncovers non-canonical motifs and advances the interpretation of genetic functional traits

Project description:We report the DNA binding preferences of 4 NF-kappaB dimers (p52p52, RELARELA, RELAp50, RELAp52) Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2011-05-24 | E-GEOD-29460 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data