Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNAseq Suv39h1 injected single embryo

ABSTRACT: Suv39h1wt or mut mRNA was injected into the zygote and cultured for the indicated timepoints

ORGANISM(S): Mus musculus

PROVIDER: GSE126021 | GEO | 2020/04/01

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

RNAseq Suv39h1 injected single embryo

Project description:RNAseq Suv39h1 injected single embryo

| PRJNA518908 | ENA

Single cell RNAseq of hepatocytes isolated from UBC-injected mice at different timepoints post-HDTV

Project description:Single cell RNAseq of hepatocytes isolated from UBC-injected mice at different timepoints post-HDTV

| PRJNA919040 | ENA

RNAseq of 2'3' cGAMP injected Drosophila melanogaster

Project description:RNAseq of 2'3' cGAMP injected Drosophila melanogaster

| PRJNA591568 | ENA

RNAseq of 2'3' cGAMP injected Drosophila melanogaster

Project description:We recently reported that an orthologue of STING regulates infection by picorna-like viruses in drosophila. Here, we show that injection of flies with 2’3’-cGAMP can induce expression of dSTING-regulated genes. Analysis of the transcriptome of 2’3’-cGAMP injected flies reveals a complex pattern of response, with early and late induced genes. Our results reveal that dSTING regulates an NF-κB -dependent antiviral program, which predates the emergence of Interferon Regulatory Factors and interferons in vertebrates.

2020-05-31 | GSE140955 | GEO

Identification of Kctd15 target genes in Xenopus animal caps injected with wnt3a and chordin

Project description:We aimed to identify genes that are inhibited by Kctd15 overexpression during neural crest (NC) induction. Injection of RNAs encoding Wnt3a and chordin into the embryo followed by animal cap explant culture leads to the induction of NC marker genes as well as additional genes expressed in the neural plate border. Our previous study indicated that co-injection of kctd15 inhibits the induction of these markers. We injected four sets of RNAs, lacZ as control (L), wnt3a+chd (WC), wnt3a+chd+kctd15 (WCK), and kctd15 (K). After evaluation of marker gene expression with RT-PCR, we prepared probes with same RNA extract for Affymetrix DNA microarray. The hybridization, washing and scanning were perfomed following the manual from Affymetrix. Partek Genomics Suite was employed for data analysis. Xenopus embryos were injected with mRNAs at two-cell stage. When developing to stage 9, the animal caps were dissected for RNA extraction and hybridization on Affymetrix microarrays. According to the mRNAs injected, the animal caps (AC) were divided into four groups, including (1) AC injected with lacZ; (2) AC injected with kctd15; (3) AC injected with chordin and wnt3a; (4) AC injected with chordin, wnt3a and kctd15. The injected animal caps were cultured till stage 15 and then collected for RT-PCR and microarray assay. Each group had three repeats.

2015-08-26 | E-GEOD-72391 | biostudies-arrayexpress

Transcriptomics analysis of gene expression in wildtype and foxo1 synonymous mutated mouse liver

Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.

2022-01-26 | GSE125786 | GEO

RNA-seq 2-cell Suv391 injected

Project description:RNA-seq 2-cell Suv391 injected

| PRJNA521252 | ENA

SMN MO, Gemin2 MO knockdown vs Control MO injected

Project description:Transcriptiome profiling of SMN MO injected, Gemin2 MO injected zebrafish embryos vs Control MO injected

2013-12-05 | GSE47001 | GEO

Single cell RNAseq analysis of organotypic brain slice microglia

Project description:Single cell RNA sequencing analysis was performed on microglia isolated from brain slices (timepoints: 1 day, 1 week or 3 weeks in culture), 2D in vitro cultured microglia, and acutely isolated adult microglia. Differences in gene expression were examined to determine relative similarity to acutely isolated adult microglia.

2020-12-14 | GSE154854 | GEO

Expression data from injected mice overexpressing Tcfeb specifically in muscle

Project description:In order to identify the effects of Tcfeb overexpression on the muscle transcriptome, we performed Affymetrix Gene-Chip hybridization experiments for the mice injected with an AAV vector expressing Tcfeb as compared with mice injected with an AAV vector expressing GFP as control. Transcriptome analysis of the injected mice overexpressing Tcfeb specifically in muscle.

2016-12-23 | GSE62975 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data