Tumor-derived Schwann-like cells promote neuroblastoma survival through secreted trophic factors
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE139235 | GEO | 2021/08/11
REPOSITORIES: GEO
Similar Datasets
Project description:8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) were profiled on the Affymetrix HGU-133plus2,0 platform before and after treatment with DAC (2'-deoxy-5-azacytidine) to investigate the influence on expression after inhibiting DNA-methylation 8 NB cell lines were included (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1), before and after treatment with 3 micromolars of DAC for 3 days
2012-09-13 | E-GEOD-31229 | biostudies-arrayexpress
Project description:8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) their methylome is determined by sequencing after MBD2-capture using MethylCollector (ActiveMotif) 8 NB cell lines were included (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) in this study. After shearing (fragments of about 200 bp), DNA was captured using MBD2-capture (MethylCollector - ActiveMotif) followed by library preparation and multiplexing. Captured sequence tags were sequenced paired-end (2 x 45 bp) on Illumina GAIIx.
2012-09-13 | E-GEOD-31353 | biostudies-arrayexpress
Project description:8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) their methylome is determined by sequencing after MBD2-capture using MethylCollector (ActiveMotif)
2012-09-13 | GSE31353 | GEO
Project description:Microarray-based genome-wide measurements of copy number alterations and of transcriptome variations are proposed for neuroblastoma prognosis and possible treatment choice. Nonetheless, they lack to provide clues on a neglected layer of systems-level changes, the translatome, whose variations are defined by the activity of the translational regulatory machinery. Our study extends the conventional genome-wide approaches to translatome profiling in neuroblastoma, by means of polysomal sucrose gradient separation followed by microarray analysis. The panel of fourteen parental (not subcloned) neuroblastoma cell lines used in the study includes: CHP-134, SIMA, NB-69, LAN-1, KELLY, CHP-126, CHP-212, SK-N-BE(2), IMR-32, SK-N-AS, SK-N-SH, STA-NB-7, STA-NB-1, STA-NB-10 cells. Each cell line has been profiled with high resolution array CGH analysis for copy number changes, and for transcriptome and translatome variations. The integration of these three types of data sets obtained from the same cells can provide information on the impact in neuroblastoma of a defined pattern of genomic lesions on both transcriptional and translational alterations of gene expression.
2010-12-31 | GSE22785 | GEO
Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.
2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress
Project description:Analysis of varied biologic pathways in neuroblastoma SK-N-SH cells grown in doxorubicin and/or SAHA. The hypothesis was that SK-N-SH cells undergo a mesenchymal change through mesenchymal change resulting in a more invasive as well as drug resistant phenotype, and that the mechanism of SAHAs effect on drug resistance may be revealed through this analysis. Total RNA was isolated from wild type, SAHA treated wild type cells, doxorubicin resistant, and SAHA treated doxorubicin resistant SK-N-SH cell lines in triplicate.
2016-05-31 | E-GEOD-47668 | biostudies-arrayexpress
Project description:8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) were profiled on the Affymetrix HGU-133plus2,0 platform before and after treatment with DAC (2'-deoxy-5-azacytidine) to investigate the influence on expression after inhibiting DNA-methylation
2012-09-13 | GSE31229 | GEO
Project description:Tumor tissue heterogeneity is a well known feature of several solid tumors. Neuroblastic Tumors (NTs) is a group of paediatric cancers with a great tissue heterogeneity. Most of NTs are composed of undifferentiated, poorly differentiated or differentiating neuroblastic (Nb) cells with very few or absent Schwannian stromal (SS) cells: these tumors are grouped as Neuroblastoma (Schwannian stroma-poor). The remaining NTs are composed of abundant SS cells and classified as Ganglioneuroblastoma (Schwannian stroma-rich) intermixed or nodular and Ganglioneuroma. The importance to understand Nb and SS gene signatures in NTs, is to clarify the complex network mechanism of tumor growth and progression. In order to identify the Nb and SS cells gene signatures, we analyzed the gene expression profiling of 19 cases of neuroblastic tumors: 10 stroma poor (NTs-SP) and 9 stroma rich (NTs-SR), by high density oligonucleotide microarrays. Moreover, the analysis was performed in parallel on both whole and laser microdissected tumor samples: from 4 of 19 cases, was isolated different areas all composed of pure cellular populations. We performed genome wide expression analysis by using Affymetrix technology and we used two different approaches for data analysis: SAM (Significance Analysis of Microarrays) and a method based on Game Theory (GT), to identify genes differently expressed in SS and Nb cells. Differently from the SAM method, the analysis based on GT (Moretti et al. (2006)) gives the advantage of selecting relevant genes not only according to the expression profile of each single gene, but considering also gene interaction. Keywords: Gene signature of Neuroblastic and Schwannian stromal cells.
2007-04-17 | GSE7529 | GEO
Project description:EZH2 is a H3K27 methylase and a target of cancer epigenetic treatments. We recently reported the oncogenic roles and NTRK1 (TRKA) epigenetic regulation by EZH2 in the MYCN-amplified aggressive neuroblastomas (NB) (Li et al., ONCOGENE, 2018). Here, we investigated the effects and function of small molecule EZH2 inhibitor (EZH2i) on aggressive NB model cell lines. We examined the antitumor effects of EZH2i using WST assay and colony formation assay. By EZH2i treatments, suppression of proliferation was observed in SK-N-SH and SK-N-BE cells (sensitive cells) dose-dependently, whereas it was not observed in IMR32 and NGP cells (resistant cells). FACS analysis showed apoptosis and G0/G1 cell cycle arrest in sensitive cells. Transcriptome analysis and GSEA indicated significant changes were observed in the gene set related to cell cycle arrest and differentiation in the sensitive cells. We selected genes induced at mRNA level by EZH2i only in the sensitive cells and confirmed tumor suppressor function in NB cells. Almost of the EZH2i-induced gene promoters were marked by H3K27me3 in MYCN-amplified NB cell lines. Interestingly, a part of the EZH2i-induced gene promoters have CpG islands and methylated in NB tumor samples registrated in databases. Further, combination of EPZ6438 and 5-aza-deoxycitide, resulted in effective suppression of proliferation in the EPZ6438-resistant 3 NB cell lines. Transcriptome/methylome analysis of the EPZ6438 and 5-aza-deoxycitide-treated NB cells revealed the combinational epigenetic regulation of the tumor suppressors and oncogene expression. Finally, methylome analysis of the promoter regions, e.g. VSTM2L, GPNMB, and TIMP3 CpG islands can be biomarkers of EPZ6438-registancy in unfavorable NB patients. These responsible CpG island methylation as biomarkers for the application of EZH2i/DNMTi combination therapy.
2022-08-01 | GSE143713 | GEO
Project description:EZH2 is a H3K27 methylase and a target of cancer epigenetic treatments. We recently reported the oncogenic roles and NTRK1 (TRKA) epigenetic regulation by EZH2 in the MYCN-amplified aggressive neuroblastomas (NB) (Li et al., ONCOGENE, 2018). Here, we investigated the effects and function of small molecule EZH2 inhibitor (EZH2i) on aggressive NB model cell lines. We examined the antitumor effects of EZH2i using WST assay and colony formation assay. By EZH2i treatments, suppression of proliferation was observed in SK-N-SH and SK-N-BE cells (sensitive cells) dose-dependently, whereas it was not observed in IMR32 and NGP cells (resistant cells). FACS analysis showed apoptosis and G0/G1 cell cycle arrest in sensitive cells. Transcriptome analysis and GSEA indicated significant changes were observed in the gene set related to cell cycle arrest and differentiation in the sensitive cells. We selected genes induced at mRNA level by EZH2i only in the sensitive cells and confirmed tumor suppressor function in NB cells. Almost of the EZH2i-induced gene promoters were marked by H3K27me3 in MYCN-amplified NB cell lines. Interestingly, a part of the EZH2i-induced gene promoters have CpG islands and methylated in NB tumor samples registrated in databases. Further, combination of EPZ6438 and 5-aza-deoxycitide, resulted in effective suppression of proliferation in the EPZ6438-resistant 3 NB cell lines. Transcriptome/methylome analysis of the EPZ6438 and 5-aza-deoxycitide-treated NB cells revealed the combinational epigenetic regulation of the tumor suppressors and oncogene expression. Finally, methylome analysis of the promoter regions, e.g. VSTM2L, GPNMB, and TIMP3 CpG islands can be biomarkers of EPZ6438-registancy in unfavorable NB patients. These responsible CpG island methylation as biomarkers for the application of EZH2i/DNMTi combination therapy.
2022-08-01 | GSE143712 | GEO