Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

LiBis: An ultrasensitive alignment method for low-input bisulfite sequencing

ABSTRACT: LiBis is a novel method for low-input WGBS data alignment. By dynamically clipping initially unmapped reads and remapping clipped fragments, we judiciously rescued those reads and uniquely aligned them to the genome. By substantially increasing the mapping ratio by up to 88%, LiBis improves the number of informative CpGs and the precision to quantify the methylation status of individual CpG sites. The high sensitivity and cost effectiveness afforded by LiBis for low-input samples will allow the discovery of genetic and epigenetic features suitable for downstream analysis and biomarker identification using liquid biopsy.

ORGANISM(S): Homo sapiens

PROVIDER: GSE147454 | GEO | 2022/09/05

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

LiBis: An ultrasensitive alignment method for low-input bisulfite sequencing

Project description:LiBis: An ultrasensitive alignment method for low-input bisulfite sequencing

| PRJNA614910 | ENA

Annual Removal of Aboveground Plant Biomass Alters Soil Microbial Responses to Warming

Project description:Clipping (i.e., harvesting aboveground plant biomass) is common in agriculture and for bioenergy production. However, microbial responses to clipping in the context of climate warming are poorly understood. We investigated the interactive effects of grassland warming and clipping on soil properties, plant and microbial communities, in particular microbial functional genes. Clipping alone did not change the plant biomass production, but warming and clipping combined increased the C4 peak biomass by 47% and belowground net primary production by 110%. Clipping alone and in combination with warming decreased the soil carbon input from litter by 81% and 75%, respectively. With less carbon input, the abundances of genes involved in degrading relatively recalcitrant carbon increased by 38-137% in response to either clipping or the combined treatment, which could weaken the long-term soil carbon stability and trigger a positive feedback to warming. Clipping alone also increased the abundance of genes for nitrogen fixation, mineralization and denitrification by 32-39%. The potentially stimulated nitrogen fixation could help compensate for the 20% decline in soil ammonium caused by clipping alone, and contribute to unchanged plant biomass. Moreover, clipping tended to interact antagonistically with warming, especially on nitrogen cycling genes, demonstrating that single factor studies cannot predict multifactorial changes. These results revealed that clipping alone or in combination with warming altered soil and plant properties, as well as the abundance and structure of soil microbial functional genes. The aboveground biomass removal for biofuel production needs to be re-considered as the long-term soil carbon stability may be weakened.

2016-09-27 | GSE86527 | GEO

renal damage in 24w2k1c v cont24w

Project description:The experiment was designed to study the effects of blood pressure on gene expressions in the kidney cortex. Non-clipped kidney cortex was harvested from eight 2k1c rats and eight sham rats after 4 and 24 weeks of clipping. The 2k1c is the experimental group which underwent a two kidney, one clip (2k1c) operation (renal artery stenosis), wheras the sham group serves as a control where no stenosis were performed.

2014-11-11 | E-MTAB-1449 | biostudies-arrayexpress

Intestinal Differentiation Involves Cleavage of Histone H3 NTerminal Tails by Multiple Proteases

Project description:The proteolytic cleavage of histone tails, also termed histone clipping, has been described as a mechanism for permanent removal of post-translational modifications (PTMs) from histone proteins. Such activity has been ascribed to ensure regulatory function in key cellular processes such as differentiation, senescence and transcriptional control for which different histone-specific proteases has been described. However, all these studies were exclusively performed using cell lines cultured in vitro and no clear evidences that histone clipping is regulated in vivo has been reported. Here we show that histone H3 N-terminal tails undergo extensive cleavage in the differentiated cells of the villi fraction of the mouse intestinal epithelium and we investigate histone PTM changes in full-length compared with clipped histone H3.

2021-01-11 | PXD022171 | Pride

PAtCh-Cap: input strategy for improving analysis of ChIP-exo data sets and beyond

Project description:Recently, a number of advances have been implemented into the core ChIP-seq (chromatin immunoprecipitation coupled with next-generation sequencing) methodology to streamline the process, reduce costs or improve data resolution. Several of these emerging ChIP-based methods perform additional chemical steps on bead-bound immunoprecipitated chromatin, posing a challenge for generating similarly treated input controls required for artifact removal during bioinformatics analyses. Here we present a versatile method for producing technique-specific input controls for ChIP-based methods that utilize additional bead-bound processing steps. This reported method, termed protein attached chromatin capture (PAtCh-Cap), relies on the non-specific capture of chromatin-bound proteins via their carboxylate groups, leaving the DNA accessible for subsequent chemical treatments in parallel with chromatin separately immunoprecipitated for the target protein. Application of this input strategy not only significantly enhanced artifact removal from ChIP-exo data, increasing confidence in peak identification and allowing for de novo motif searching, but also afforded discovery of a novel CTCF binding motif.

2016-08-24 | GSE79563 | GEO

Baiting out a full length sequence from unmapped RNA-seq data

Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.

2021-04-22 | GSE172487 | GEO

Retinal input instructs alignment of visual topographic maps.

Project description:Sensory information is represented in the brain in the form of topographic maps, in which neighboring neurons respond to adjacent external stimuli. In the visual system, the superior colliculus receives topographic projections from the retina and primary visual cortex (V1) that are aligned. Alignment may be achieved through the use of a gradient of shared axon guidance molecules, or through a retinal-matching mechanism in which axons that monitor identical regions of visual space align. To distinguish between these possibilities, we take advantage of genetically engineered mice that we show have a duplicated functional retinocollicular map but only a single map in V1. Anatomical tracing revealed that the corticocollicular projection bifurcates to align with the duplicated retinocollicular map in a manner dependent on the normal pattern of spontaneous activity during development. These data suggest a general model in which convergent maps use coincident activity patterns to achieve alignment.

| S-EPMC2814139 | biostudies-literature

Low input RNA-seq of HSCs.

Project description:Low input RNA-seq of HSCs.

| PRJNA834789 | ENA

Low-input Hi-C library construction

Project description:Low-input Hi-C library construction

| PRJNA975160 | ENA

Fast Low-Input Efficient Hi-C

Project description:Fast Low-Input Efficient Hi-C

| PRJNA1157835 | ENA