Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-Seq of multiplexed metastasis xenogfrates of barcoded cell line pools

ABSTRACT: Large-scale metastasis research has been infeasible as the use of in vivo hosts precluded the scale of such experiments. Here we introduce a barcoding strategy coupled with deep sequencing that is capable of determining the metastatic abilities of human cancer cell lines in murine xenografts at scale. We developed a RNA-Seq based readout method and an analysis framework that co-capture the cell lines that metastasize to the target organs and their averaged transcriptomes in different in vivo microenvironment. We applied the approach to a cohort of basal-like breast cell lines and revealed their diverse metastatic patterns, a heterogeneity as seen in patients. Expression analysis revealed organ-specific transcriptional states and differential pathway activities in metastases from one site to another.

ORGANISM(S): Homo sapiens

PROVIDER: GSE148283 | GEO | 2020/06/26

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

Multiplexed protein quantification with barcoded hydrogel microparticles.

Project description:We demonstrate the use of graphically encoded hydrogel microparticles for the sensitive and high-throughput multiplexed detection of clinically relevant protein panels in complex media. Combining established antibody capture techniques with advances in both microfluidic synthesis and analysis, we detected 1-8 pg/mL amounts of three cytokines (interleuken-2, interleuken-4, and tumor necrosis factor alpha) in single and multiplexed assays without the need for filtration or blocking agents. A range of hydrogel porosities was investigated to ensure rapid diffusion of targets and reagents into the particle as well as to maintain the structural integrity of particles during rinsing procedures and high-velocity microfluidic scanning. Covalent incorporation of capture antibodies using a heterobifunctional poly(ethylene glycol) linker enabled one-step synthesis and functionalization of particles using only small amounts of valuable reagents. In addition to the use of three separate types of single-probe particles, the flexibility of the stop-flow lithography (SFL) method was leveraged to spatially segregate the three probes for the aforementioned target set on an individual encoded particle, thereby demonstrating the feasibility of single-particle diagnostic panels. This study establishes the gel-particle platform as a versatile tool for the efficient quantification of protein targets and significantly advances efforts to extend the advantages of both hydrogel substrates and particle-based arrays to the field of clinical proteomics.

| S-EPMC3030995 | biostudies-literature

Magnetic barcoded hydrogel microparticles for multiplexed detection.

Project description:Magnetic polymer particles have been used in a wide variety of applications ranging from targeting and separation to diagnostics and imaging. Current synthesis methods have limited these particles to spherical or deformations of spherical morphologies. In this paper, we report the use of stop flow lithography to produce magnetic hydrogel microparticles with a graphical code region, a probe region, and a magnetic tail region. These anisotropic multifunctional magnetic polymer particles are an enhanced version of previously synthesized "barcoded" particles (Science, 2007, 315, 1393-1396) developed for the sensitive and rapid multiplexed sensing of nucleic acids. The newly added magnetic region has acquired dipole moments in the presence of weak homogeneous magnetic fields, allowing the particles to align along the applied field direction. The novel magnetic properties have led to practical applications in the efficient orientation and separation of the barcoded microparticles during biological assays without disrupting detection capabilities.

| S-EPMC2877154 | biostudies-literature

Multiplexed barcoded CRISPR-Cas9 screening enabled by CombiGEM.

Project description:The orchestrated action of genes controls complex biological phenotypes, yet the systematic discovery of gene and drug combinations that modulate these phenotypes in human cells is labor intensive and challenging to scale. Here, we created a platform for the massively parallel screening of barcoded combinatorial gene perturbations in human cells and translated these hits into effective drug combinations. This technology leverages the simplicity of the CRISPR-Cas9 system for multiplexed targeting of specific genomic loci and the versatility of combinatorial genetics en masse (CombiGEM) to rapidly assemble barcoded combinatorial genetic libraries that can be tracked with high-throughput sequencing. We applied CombiGEM-CRISPR to create a library of 23,409 barcoded dual guide-RNA (gRNA) combinations and then perform a high-throughput pooled screen to identify gene pairs that inhibited ovarian cancer cell growth when they were targeted. We validated the growth-inhibiting effects of specific gene sets, including epigenetic regulators KDM4C/BRD4 and KDM6B/BRD4, via individual assays with CRISPR-Cas-based knockouts and RNA-interference-based knockdowns. We also tested small-molecule drug pairs directed against our pairwise hits and showed that they exerted synergistic antiproliferative effects against ovarian cancer cells. We envision that the CombiGEM-CRISPR platform will be applicable to a broad range of biological settings and will accelerate the systematic identification of genetic combinations and their translation into novel drug combinations that modulate complex human disease phenotypes.

| S-EPMC4780610 | biostudies-literature

RNA-Seq of multiplexed metastasis xenogfrates of barcoded cell line pools

Project description:RNA-Seq of multiplexed metastasis xenogfrates of barcoded cell line pools

| PRJNA623730 | ENA

DNA-barcoded labeling probes for highly multiplexed Exchange-PAINT imaging.

Project description:Recent advances in super-resolution fluorescence imaging allow researchers to overcome the classical diffraction limit of light, and are already starting to make an impact in biology. However, a key challenge for traditional super-resolution methods is their limited multiplexing capability, which prevents a systematic understanding of multi-protein interactions on the nanoscale. Exchange-PAINT, a recently developed DNA-based multiplexing approach, in theory facilitates spectrally-unlimited multiplexing by sequentially imaging target molecules using orthogonal dye-labeled 'imager' strands. While this approach holds great promise for the bioimaging community, its widespread application has been hampered by the availability of DNA-conjugated ligands for protein labeling. Herein, we report a universal approach for the creation of DNA-barcoded labeling probes for highly multiplexed Exchange-PAINT imaging, using a variety of affinity reagents such as primary and secondary antibodies, nanobodies, and small molecule binders. Furthermore, we extend the availability of orthogonal imager strands for Exchange-PAINT to over 50 and assay their orthogonality in a novel DNA origami-based crosstalk assay. Using our optimized conjugation and labeling strategies, we demonstrate nine-color super-resolution imaging in situ in fixed cells.

| S-EPMC5380918 | biostudies-literature

Multiplexed direct detection of barcoded protein reporters on a nanopore array.

Project description:Detection of specific proteins using nanopores is currently challenging. To address this challenge, we developed a collection of over twenty nanopore-addressable protein tags engineered as reporters (NanoporeTERs, or NTERs). NTERs are constructed with a secretion tag, folded domain and a nanopore-targeting C-terminal tail in which arbitrary peptide barcodes can be encoded. We demonstrate simultaneous detection of up to nine NTERs expressed in bacterial or human cells using MinION nanopore sensor arrays.

| S-EPMC8766897 | biostudies-literature

Multiplexed Single Cell gene expression profile of barcoded SUM159PT cells

Project description:Cancer is a heterogeneous disease, where multiple, phenotypically distinct subpopulations co-exist. Tumour evolution is a result of a complex interplay of genetic and epigenetic factors. To predict the molecular drivers of distinct cancer responses, we apply single-cell lineage tracing (scRNA-Seq of barcoded cells) on a triple-negative breast cancer model. SUM159PT cells infected with a lentiviral barcode library (Perturb-seq Library) were sorted according to the presence of BFP signal, treated or not with paclitaxel (PTX), multiplexed with MULTI-Seq protocol, and then processed by scRNA-Seq.

2024-05-24 | E-MTAB-13066 | biostudies-arrayexpress

Role of epithelial to mesenchymal transition (EMT) in spontaneous breast cancer metastasis

Project description:Epithelial-mesenchymal transition (EMT) has been linked to cancer progression and metastatic propensity. The 4T1 tumor is a clinically relevant model of spontaneous breast cancer metastasis. Here we characterize 4T1-derived cell lines for EMT, in vitro invasiveness and in vivo metastatic ability. Contrary to expectations, the 67NR cells, which form primary tumors but fail to metastasize, express vimentin and N-cadherin, but not E-cadherin. 4T1 cells, however, express E-cadherin, are highly migratory and invasive, and metastasize to multiple sites. The 66cl4 metastatic cells display mixed epithelial and mesenchymal markers, but are less migratory and invasive than 67NR cells. These findings demonstrate that the metastatic ability of breast cancer cells does not correlate with genotypic and phenotypic properties of EMT per se, and suggest that other processes may govern metastatic capability. Gene expression analysis also has not identified differences in EMT markers, but has identified several candidate genes that may influence metastatic ability. Keywords: cell type comparison

2008-08-01 | GSE11259 | GEO

Highly multiplexed and quantitative cell-surface protein profiling using genetically barcoded antibodies.

Project description:Human cells express thousands of different surface proteins that can be used for cell classification, or to distinguish healthy and disease conditions. A method capable of profiling a substantial fraction of the surface proteome simultaneously and inexpensively would enable more accurate and complete classification of cell states. We present a highly multiplexed and quantitative surface proteomic method using genetically barcoded antibodies called phage-antibody next-generation sequencing (PhaNGS). Using 144 preselected antibodies displayed on filamentous phage (Fab-phage) against 44 receptor targets, we assess changes in B cell surface proteins after the development of drug resistance in a patient with acute lymphoblastic leukemia (ALL) and in adaptation to oncogene expression in a Myc-inducible Burkitt lymphoma model. We further show PhaNGS can be applied at the single-cell level. Our results reveal that a common set of proteins including FLT3, NCR3LG1, and ROR1 dominate the response to similar oncogenic perturbations in B cells. Linking high-affinity, selective, genetically encoded binders to NGS enables direct and highly multiplexed protein detection, comparable to RNA-sequencing for mRNA. PhaNGS has the potential to profile a substantial fraction of the surface proteome simultaneously and inexpensively to enable more accurate and complete classification of cell states.

| S-EPMC5856557 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data