Integration sites sequencing of HIV infection on ZNF417 ZNF587 dKO 293T cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE174239 | GEO | 2021/12/31
REPOSITORIES: GEO
Similar Datasets
Project description:The ChIP-seq experiments using GFP antibody on ZNF417/ZNF587-GFP overexpressing 293T cells revealed that ZNF417/ZNF587 preferred to bind a PBS-Lys-containing HERVs. Further motif calling analysis showed that both ZNF417 and ZNF587 bind to HERVK PBS-resembled motif.
2021-12-01 | GSE156600 | GEO
Project description:ChIP-seq on Znf417 and Znf587 overexpression 293T to verify Znf417 and Znf587 binding capacity at PBS-Lys elements.
| PRJNA658494 | ENA
Project description:To verify Znf417 and Znf587 knock out whether leads to HERV-K element reactivation, we performed RNA-seq on Znf417/Znf587 double knock out (DKO) 293T cell lines. We did not find any significant changes in HERVK expression.
2021-12-01 | GSE156602 | GEO
Project description:RNAseq of human embryonic stem cells depleted for ZNF417 and ZNF587 or control cells
2020-01-24 | GSE144153 | GEO
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).
2022-12-01 | GSE121363 | GEO
Project description:Integration sites sequencing of HIV infection on ZNF417 ZNF587 dKO 293T cells
| PRJNA728901 | ENA
Project description:Characteristic features of chromatin states are not limited to particular epigenetic modifications but include other regulatory cues, such as linker DNA length, typically ranging from between 35-55 bp (Valouev et al, 2011; Voong et al., 2016, Cell) to over 200 bp in nucleosome-depleted regions (NDRs) found at active enhancers and promoters (Schones et al, 2008; Hansen He et al, 2010). To investigate whether and how the nucleosome linker DNA affects chromatin recognition by nuclear proteins we performed a set of affinity purifications using di-nucleosomes incorporating different DNA linkers. This dataset contains experiments aimed to probe how the linker DNA length affects protein binding to di-nucleosomes decorated with H3K9me3 or H3K27me3. The following di-nucleosomes were used in affinity pull-down purifications with HeLa nuclear extract followed by label-free MS: 1. unmod. H3, 35 bp linker 2. unmod. H3, 40 bp linker 3. unmod. H3, 45 bp linker 4. unmod. H3, 50 bp linker 5. unmod. H3, 55 bp linker 6. H3K9me3, 35 bp linker 7. H3K9me3, 40 bp linker 8. H3K9me3, 45 bp linker 9. H3K9me3 50 bp linker 10. H3K9me3, 55 bp linker 11. H3K27me3, 35 bp linker 12. H3K27me3, 40 bp linker 13. H3K27me3, 45 bp linker 14. H3K27me3, 50 bp linker 15. H3K27me3, 55 bp linker
2023-12-10 | PXD042368 | Pride
Project description:The role of Krüppel-associated box zinc finger proteins (KZFPs), the largest family of repressive transcription factors (TFs) of the human genome, in the pathogenesis of diffuse large B cell lymphoma has not been addressed so far. By correlating the expression of KZFPs with patient outcome, we delineated a subset of 18 co-expressed KZFPs associated to poor prognosis, higher copy number alterations (CNA), and the suppression of hallmarks gene sets linked to immune rejection. Among them, the depletion of the ZNF587-ZNF417 pair of TF paralogs drastically impaired the proliferation of both activated B cell (ABC) and germinal center B (GCB) DLBCL cell lines, by triggering replicative stress through the awakening of dormant replication origins and profound alterations of the heterochromatin landscape. ZNF587/417 knockdown profoundly altered the transcriptomic landscape of U2932 (ABC) and OCI-Ly7 (GCB) cells, rewiring gene expression networks associated with good prognosis and upregulating interferon (IFN)/inflammatory-related genes through activation of the cGAS-STING DNA sensing pathway. These cells showed signs of altered immunogenicity with an enhanced MHC class I surface expression and a reshuffling of their immunopeptidome. Our study provides evidence that the ZNF587-ZNF417 paralog pair may promote lymphoma growth, the acquisition of genetic diversity, and its immune evasion by preventing excessive replicative stress. This suggests that these TFs participate in the epigenetic memory of lymphoma cells, thus highlighting the critical role of constitutive heterochromatin in maintaining the identity of poor-prognosis DLBCL.
2024-03-15 | PXD040500 | Pride
Project description:In mammals, the peptide hormone vasopressin controls renal water excretion, largely through its actions in the renal collecting duct to regulate the molecular water channel aquaporin-2 (AQP2). There are two modes of regulation: 1) short-term regulation by membrane trafficking; and 2) long-term regulation involving vasopressin-induced changes in the abundance of the aquaporin-2 protein. Defects in the long-term regulation have been implicated in multiple water balance disorders. With the objetive to identify genes that are transcriptionally regulated in response to vasopressin in cultured mouse collecting duct cells (mpkCCD), we carried out both RNA-seq to measure all transcripts (n=9) and ChIP-seq for RNA polymerase II (Polr2a) binding along the genome (n=3). Observations were made both after 24-hr treatment with the vasopressin analog dDAVP and with vehicle. Protocol:Confluent monolayers mpkCCD cells were washed in ice-cold 1X PBS (Ca+2/Mg+2-free) followed by cross-linking in 1.11% formaldehyde in Covaris Fixing Buffer (5.5 ml) for 5min at room temperature with gentle rocking (PN 520075, Covaris, Woburn, Massachusetts). Cross-linking was terminated by the addition of 0.3 ml of 1X Covaris Quenching Buffer with rocking. The buffer solution was aspirated and 1X ice-cold PBS was added to each plate. Cells were scraped into 15ml conical tubes, spun down (200 x g, 5 min), and washed twice with PBS. After the second wash, cell pellets were resuspended in 10 ml of 1X Covaris Lysis Buffer for 10 min at 4o C with rocking. Nuclei were pelleted by spinning at 1,700 x g for 5 min at 4o C. Nuclear pellets was resuspended in the 1X Covaris Wash Buffer and incubated for 10 mins at 4o C with rocking. Samples were spun at 1,700 x g for 5 min at 4o C. Nuclear pellets were washed twice with the Covaris Non-ionic Shearing Buffer and spun at 1,700 x g for 5 min at 4o C. Nuclei were resuspended in Covaris Non-ionic Shearing Buffer (Maximum of 1-3x 10^7cells per ml of buffer). Shearing. Two 20 ul aliquots of the resuspended pellets were removed prior to shearing to be used as subsequent unsheared controls for immunoblotting and agarose gel electrophoresis. The remaining samples were transferred to AFA tubes (TC12 x 12 mm) and volumes adjusted to 1 ml (V)). Samples were sheared using a Covaris S2 SonoLAB Single system for two minutes (Duty cycle: 5%; Intensity: 4; cycle: 200). Total nuclear protein concentration of each sample in mcg/ml (R) was determined with the BCA Protein Assay Kit (Thermo Scientific, Rockford, IL). To test shearing efficiency, a 20 ul aliquot from each tube was removed after shearing to test the efficacy of shearing. The aliquots, including the unsheared sample, were incubated with 100 ul 1X TE buffer, 10 ul 10% SDS, and RNAse A (10 ug/ul, Cell Signaling Technology, Danvers, Massachusetts) for 30 mins at 37o C. 1 ul proteinase K (20 ug/ul) was added and the samples were incubated overnight at 65o C. The DNA was purified using DNA Clean & Concentrator columns (Catalog #: D4013, Zymo Research, Irvine, CA) and ran on an E-gel EX 2% agarose (Invitrogen, Carlsbad, CA). Target fragment sizes for chromatin immunoprecipitation were in the range of 150-700 bp in length with average fragment size of 300 bp. Testing epitope integrity (immunoblotting). Total protein content was determined with the BCA Protein Assay Kit (Thermo Scientific, Rockford, IL). Samples were then diluted with sample buffer (5X Laemmli buffer) at 20% (v/v) of the entire sample volume. Proteins were resolved by SDS-PAGE (4-20% polyacrylamide gels, Criterion, Bio-Rad, Hercules, CA) and transferred electrophoretically onto nitrocellulose membranes as previously described (Hwang, 2010). Membranes were probed with anti-RNA polymerase II (Catalog #: MMS-126R, Covance). The antibody was used at a 1:500 dilution (anti-RNA polymerase II) (in Odyssey blocking buffer containing 0.1% Tween 20) overnight at 4°C. After 1-h incubation with secondary antibody (Li-Cor Biosciences 680 anti-rabbit immunoglobulin G or 800 anti-mouse immunoglobulin G; Lincoln, NE) at 1:5000 dilution, sites of antibody-antigen reaction were detected using an Odyssey infrared imager (Li-Cor). Chromatin immunoprecipitation. 10 ul of sample equivalent to 2% input was removed prior to IP. Chromatin Immunoprecipitation was performed using 30-90 ug of sheared chromatin in 500 uL of 1X Covaris Non-ionic Shearing Buffer with 10 μl anti-RNA polymerase II antibodies. Samples were incubated overnight at 4°C with rotation, followed by addition of ChIP Grade Protein G Magnet Beads (Catalog #: 9006, Cell Signaling Technology) and incubation for 2 h at 4o C with rotation. The beads were washed a total of four times, including three low salt washes followed by one high salt wash for 5 mins/wash at 4o C (SimpleChIP protocol #9003, Cell Signaling Technology). Immunoprecipitated chromatin was eluted from the beads with 150 ul of 1X ChIP Elution Buffer for 30 mins at 65o C in a thermomixer. To reverse crosslinks, 6 ul of 5M NaCl and 2 ul of 20 ug/ul Proteinase K were added to the chromatin followed by incubation at 65o C overnight. DNA was purified according to SimpleChIP protocol #9003, Cell Signaling Technology. q-PCR. To check the success of the chromatin immunoprecipitation, input and ChIP’ed DNA samples were amplified with SYBR Green PCR Master Mix (Applied Biosystems) on a 7900HT Fast Real-Time PCR System. Primer sets corresponding to Hox9a and actin genes were used as positive controls for both histone and RNA polymerase II IP’s. (see Supplementary Table X for primer sequences). Library construction, amplification and sequencing. Loaded fixed volume of total eluate. Library construction was performed on a NuGEN instrument using the protocol and reagents outlined in the Ovation SP Ultralow Library Systems kit. Libraries were then enriched via PCR. After amplification, DNA was measured. A fixed amount of the total measured DNA was used for sequencing in an Illumina Hiseq2000 instrument to obtain single read data. High-throughput sequencing and read mapping. Libraries for Illumina sequencing of the samples were prepared using the the protocol and reagents outlined in the Ovation SP Ultralow Library Systems kit , NuGen Mondrian SP+ (NuGEN, San Carlos, CA) . Samples were sequenced using an Illumina HiSeq2000, obtaining 1- by 50-bp reads.
2016-07-01 | GSE79573 | GEO
Project description:ZNF417 and ZNF587 ChIP-seq in H1 cells
| PRJNA602893 | ENA