Lung transcriptome profile in healthy and OVA-sensitized/challenged mice fed a diet supplemented with or without Cap or ODNcap
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE180287 | GEO | 2021/09/29
REPOSITORIES: GEO
Similar Datasets
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:Murine Pulmonary Responses to Ambient Baltimore Particulate Matter: Genomic Analysis and Contribution to Airway Hyperresponsiveness; Asthma is a complex disease characterized by airway hyperresponsiveness (AHR) and chronic airway inflammation. Environmental factors such as ambient particulate matter (PM), a major air pollutant, has been demonstrated in epidemiological studies to contribute to asthma exacerbation and increased asthma prevalence. OBJECTIVE: We investigated the genomic and pathophysiological effects of Baltimore PM (median diameter 1.78 µm) in a murine model of asthma to identify potential biomarkers. METHODS: A/J mice with ovalbumin (OVA) âinduced AHR were exposed to PM (20 mg/kg, intratracheal), and both AHR and bronchoalveolar lavage (BAL) were assayed on days 1, 4, and 7 post exposure. Lung gene expression profiling (Affymetrix Mouse430_ 2.0) by PM (20 mg/kg, intratracheal) were assayed on OVA- and / or PM--challenged mice. RESULTS: Significant increases of airway responsiveness in OVA-treated mice were observed, indicating an asthmatic phenotype. Ambient PM exposure induced significant changes in AHR in both naive mice and OVA-induced asthmatic mice. In both naive and OVA challenged asthmatic mice, PM induced eosinophil and neutrophil infiltration into airways, elevated BAL protein content, and stimulated secretion of TH1 cytokines (IFN-g, IL-6, and TNF-a) and TH2 cytokines (IL-4, IL-5, and eotaxin) into BAL. Consistent with these results, PM induced expression of genes of innate immune response, chemotaxis and complementary system. CONCLUSION: These studies, consistent with epidemiological data, indicate that PM increases AHR and lung inflammation in naïve mice and exacerbates the asthma phenotype of increased AHR and gene expression pattern changes correlated with acute lung inflammation and airway damage. We used microarrays to detail the global programme of gene expression induced by rhPBEF treatment and VALI. Experiment Overall Design: animals were treated by PBS, Oval albumin, PM, or both OVA/PM
2008-06-16 | E-GEOD-9465 | biostudies-arrayexpress
Project description:Asthma is a chronic inflammatory disease of the airways characterized by recurrent episodes of airway obstruction, hyperresponsiveness, remodeling, and eosinophilia. Phospholipase A2s (PLA2s), which release fatty acids and lysophospholipids from membrane phospholipids, have been implicated in exacerbating asthma by generating pro-asthmatic lipid mediators, but an understanding of the association between individual PLA2 subtypes and asthma is still incomplete. Here, we show that group III secreted PLA2 (sPLA2-III) plays an ameliorating, rather than aggravating, role in asthma pathology. In both mouse and human lungs, sPLA2-III was expressed in bronchial epithelial cells and decreased during the asthmatic response. In an ovalbumin (OVA)-induced asthma model, Pla2g3 knockout (-/-) mice exhibited enhanced airway hyperresponsiveness, eosinophilia, OVA-specific IgE production, and type 2 cytokine expression as compared to Pla2g3 wild-type (+/+) mice. Lipidomics analysis showed that the pulmonary levels of several lysophospholipids, including lysophosphatidylcholine, lysophosphatidylethanolamine, and lysophosphatidic acid (LPA), were decreased in OVA-challenged Pla2g3-/- mice relative to Pla2g3+/+ mice. LPA receptor 2 agonists suppressed thymic stromal lymphopoietin expression in bronchial epithelial cells and reversed airway hyperresponsiveness and eosinophilia in Pla2g3-/- mice, suggesting that sPLA2-III negatively regulates allergen-induced asthma at least by producing LPA. Thus, the activation of the sPLA2-III-LPA pathway may be a new therapeutic target for allergic asthma. Microarray gene profiling of the bronchial epithelial cells isolated from OVA-challenged lung revealed the increased expression of various chemokines and type 2 epithelial cytokines in bronchial epithelial cells from Pla2g3-/- mice as compared to those from Pla2g3+/+ mice following OVA challenge.
2024-03-13 | GSE249135 | GEO
Project description:Asthma is a chronic inflammatory disease of the airways characterized by recurrent episodes of airway obstruction, hyperresponsiveness, remodeling, and eosinophilia. Phospholipase A2s (PLA2s), which release fatty acids and lysophospholipids from membrane phospholipids, have been implicated in exacerbating asthma by generating pro-asthmatic lipid mediators, but an understanding of the association between individual PLA2 subtypes and asthma is still incomplete. Here, we show that group III secreted PLA2 (sPLA2-III) plays an ameliorating, rather than aggravating, role in asthma pathology. In both mouse and human lungs, sPLA2-III was expressed in bronchial epithelial cells and decreased during the asthmatic response. In an ovalbumin (OVA)-induced asthma model, Pla2g3-/- mice exhibited enhanced airway hyperresponsiveness, eosinophilia, OVA-specific IgE production, and type 2 cytokine expression as compared to Pla2g3+/+ mice. Lipidomics analysis showed that the pulmonary levels of several lysophospholipids, including lysophosphatidylcholine, lysophosphatidylethanolamine, and lysophosphatidic acid (LPA), were decreased in OVA-challenged Pla2g3-/- mice relative to Pla2g3+/+ mice. LPA receptor 2 agonists suppressed thymic stromal lymphopoietin expression in bronchial epithelial cells and reversed airway hyperresponsiveness and eosinophilia in Pla2g3-/- mice, suggesting that sPLA2-III negatively regulates allergen-induced asthma at least by producing LPA. Thus, the activation of the sPLA2-III-LPA pathway may be a new therapeutic target for allergic asthma. Microarray gene profiling of the OVA-challenged lung revealed that the genes related to cytokines and inflammatory response were highly changed in Pla2g3-/- mice relative to Pla2g3+/+ mice
2024-03-13 | GSE249134 | GEO
Project description:Murine Pulmonary Responses to Ambient Baltimore Particulate Matter: Genomic Analysis and Contribution to Airway Hyperresponsiveness Asthma is a complex disease characterized by airway hyperresponsiveness (AHR) and chronic airway inflammation. Environmental factors such as ambient particulate matter (PM), a major air pollutant, has been demonstrated in epidemiological studies to contribute to asthma exacerbation and increased asthma prevalence. OBJECTIVE: We investigated the genomic and pathophysiological effects of Baltimore PM (median diameter 1.78 µm) in a murine model of asthma to identify potential biomarkers. METHODS: A/J mice with ovalbumin (OVA) –induced AHR were exposed to PM (20 mg/kg, intratracheal), and both AHR and bronchoalveolar lavage (BAL) were assayed on days 1, 4, and 7 post exposure. Lung gene expression profiling (Affymetrix Mouse430_ 2.0) by PM (20 mg/kg, intratracheal) were assayed on OVA- and / or PM--challenged mice. RESULTS: Significant increases of airway responsiveness in OVA-treated mice were observed, indicating an asthmatic phenotype. Ambient PM exposure induced significant changes in AHR in both naive mice and OVA-induced asthmatic mice. In both naive and OVA challenged asthmatic mice, PM induced eosinophil and neutrophil infiltration into airways, elevated BAL protein content, and stimulated secretion of TH1 cytokines (IFN-g, IL-6, and TNF-a) and TH2 cytokines (IL-4, IL-5, and eotaxin) into BAL. Consistent with these results, PM induced expression of genes of innate immune response, chemotaxis and complementary system. CONCLUSION: These studies, consistent with epidemiological data, indicate that PM increases AHR and lung inflammation in naïve mice and exacerbates the asthma phenotype of increased AHR and gene expression pattern changes correlated with acute lung inflammation and airway damage. We used microarrays to detail the global programme of gene expression induced by rhPBEF treatment and VALI. Keywords: gene expression
2007-12-01 | GSE9465 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:This study aims at identifying a dual transcriptomics and metabolomics blood signature following administration of CpG-ODN (cytosine-phosphate-guanine oligodeoxynucleotides), a reference immune-stimulatory molecule. A clinical study was conducted with chicks and transcriptomics and metabolomics analyses were performed on whole-blood and plasma samples respectively. Statistical analyses resulting in lists of differentially expressed genes and metabolites with different abundance were identified in chicks treated with CpG-ODN. The results showed that CpG-ODN activates the innate immune systems within hours following administration and its effect lasts over time, as metabolomic and transcriptomic profiles are still varying at 6 days after administration.
2019-10-17 | GSE138956 | GEO
Project description:An important feature of human asthma and animal models of asthma is airway hyperresponsiveness. The symptoms of asthma are a narrowing of the airways caused by edema and the influx of inflammatory cells. The aim of this project is to determine the temporal relationship between gene expression and airway allergen challenge. 4 weeks old BALB/CJ mice were challenged on days 0,3,10 and 17 with PBS and ragweed pollen protein plus Alum.
2007-12-13 | E-GEOD-483 | biostudies-arrayexpress
Project description:Alteration in the gene expression level in the lungs are thought to play a crucial role during the development of asthma and airway hyperresponsiveness. House dust mite induced allergic asthma is a Th2-lymphocyte driven inflammation characterized by airway hyperresponsiveness and eosinophilia while c-di-GMP, which is a potent mucosal adjuvant, induces a Th1-Th17 response accompanied by neutrophilia along with a low Th2 response. We aimed to identify changes in the expression of genes important in asthma pathology via targeted gene expression arrays.
2021-02-03 | GSE165969 | GEO
Project description:Synthetic oligonucleotides (ODN) expressing CpG motifs trigger an innate immune response via TLR9. Multiple microarray analyses were performed to identify the global effects on gene expression of stimulating the CAL-1 human pDC line with different types of CpG ODN. Results show that a subset of genes characterized by shared anti-viral activity was consistently up-regulated by ODNs that otherwise mediate discrete functions. This group of genes was largely dependant on autocrine type I interferon (IFN) signaling, as their induction was blocked by neutralizing antibody targeting the type I IFN receptor. Coupling these experiments with a meta-analysis of other published works led to the identification of a set of 32 functionally conserved genes that was reproducibly activated by different types of CpG DNA in different species and cell types. Functionally, these 'core' genes support a type I IFN response to viral infection, and differ from genes up-regulated by only a single type of CpG ODN. These findings help define the conserved and sequence-specific patterns of gene activation triggered via TLR9 and improve our understanding of the immunomodulatory effects elicited by CpG ODN.
2012-07-01 | GSE30849 | GEO