4C-seq analyses of the 3’Igh locus during B cell development
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE183006 | GEO | 2021/11/23
REPOSITORIES: GEO
Similar Datasets
Project description:We used 454 sequencing to assess the repertoire of B cell subsets from bone marrow, spleen, and small intestinal lamina propria from two mouse strains. We used a RAG2-GFP reporter mouse strain (129Sve background) to isolate CD19+ RAG2+ B lineage cells from bone marrow and small intestinal lamina propria and total splenic B cells. We used 5' RACE to amplify cDNA libraries using primers specific for the mu constant region of IgH and the Ig kappa constant region. We also used this technique to analyze total B cell libraries from Swiss Webster germ-free mice to compare to littermate controls that were cohoused with regular specific pathogen free (SPF) mice for 7 days. Examination of the Ig kappa repertoire and IgH repertoire in RAG2+ bone marrow B lineage cells compared to RAG2+ small intestinal lamina propria B lineage cells or total splenic B cells. There are 8 (Ig kappa) or 4 (IgH) independent experiments comparing repertoires in RAG2-GFP mice. Each experiment in RAG2-GFP+ mice consisted of a pool of 8-12 mice. There are 3 experiments comparing germ-free to colonized mouse total B cell repertoires, each consisting of one mouse per condition.
2013-07-16 | E-GEOD-48870 | biostudies-arrayexpress
Project description:The immunoglobulin heavy-chain (Igh) locus undergoes large-scale contraction in pro-B cells, which facilitates VH-DJH recombination by juxtaposing distal VH genes next to the DJH- rearranged gene segment in the proximal Igh domain. By high-resolution mapping of long-range interactions, we now demonstrate that an array of local interaction domains establishes the three- dimensional structure of the extended Igh locus in lymphoid progenitors and thymocytes. In pro- B cells, these local domains engage in long-range interactions across the entire Igh locus, which depend on the transcription factors Pax5, YY1 and CTCF. The large VH gene cluster thereby undergoes flexible long-range interactions with the more rigidly structured 3M-bM-^@M-^Y proximal domain, which ensures that all VH genes can participate with similar probability in VH-DJH recombination to generate a diverse antibody repertoire. Notably, these long-range interactions appear to be an intrinsic feature of the VH gene cluster, as they are still generated upon mutation of the EM-NM-< enhancer, IGCR1 insulator or 3M-bM-^@M-^Y regulatory region present in the 3M-bM-^@M-^Y proximal Igh domain. 4C sequencing from mutliple celltypes with multiple viewpoints; uneven number of replicates ChIP-Seq
2013-09-30 | E-GEOD-43008 | biostudies-arrayexpress
Project description:We used 454 sequencing to assess the repertoire of B cell subsets from bone marrow, spleen, and small intestinal lamina propria from two mouse strains. We used a RAG2-GFP reporter mouse strain (129Sve background) to isolate CD19+ RAG2+ B lineage cells from bone marrow and small intestinal lamina propria and total splenic B cells. We used 5' RACE to amplify cDNA libraries using primers specific for the mu constant region of IgH and the Ig kappa constant region. We also used this technique to analyze total B cell libraries from Swiss Webster germ-free mice to compare to littermate controls that were cohoused with regular specific pathogen free (SPF) mice for 7 days.
2013-07-16 | GSE48870 | GEO
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress
Project description:Activation of splenic B cells induces formation of a 220kb DNA loop between Em and 3â??RR enhancers in the immunoglobulin heavy chain locus (IgH). This DNA loop has been proposed to be necessary for the crucial immune diversification mechanism of IgH class switch recombination, but the factors that control its formation are unknown. We show that conditional deletion of transcription factor YY1 in primary splenic B cells results in a dramatic drop in formation of this DNA loop, as well as immunoglobulin class switch recombination. Reconstitution of YY1-deleted splenic B cells with various YY1 mutants showed that the C-terminal half of YY1 lacking the transactivation domain restored both Em-3â??RR DNA loop formation as well as class switch recombination. RNA transcript analyses of YY1 conditional deleted splenic B cells suggest that YY1 does not regulate genes needed for DNA looping or CSR. Our results argue for a direct physical mechanism of YY1 mediating long-distance DNA loops and provide strong evidence of the importance of this DNA loop for class switching. Our results provide foundational mechanistic insight into a crucial immune function. Follicular B cells were isolated from the spleens of three C57Bl/6 yy1 fl/fl mice. For each spleen, half the cells received mock treatment and half received TATCRE. The 6 samples were then grown in RPMI medium along with LPS, Il4, OPI, and 20% FBS for 72 hours. The 6 groups of cells were lysed and RNA was isolated for library preparation. Expression differences between Mock and TATCRE treated cells were determined to understand the role of yy1 in B cell class switching.
2016-08-06 | E-GEOD-85259 | biostudies-arrayexpress
Project description:Relative expression levels of mRNAs in chicken IEL experimentally infected with EA, EM, or ET were measured at 1 to 6 days post-infection (dpi) following primary and secondary infections. One week-old chickens were uninfected (negative control) or were orally inoculated with sporulated oocysts of EA, EM, or ET. One week later, the infected chickens were challenged with an identical inoculum of the homologous parasite. Intestinal samples were collected daily from 5 birds in a treatment group at from 1 to 6 dpi following primary and secondary infections. Cecum, duodenum, and jejunum were collected from the birds challenged with E. acervulina, E. maxima, and E. tenella, respectively. Uninfected control samples and one of the 3 infection group samples were labeled with different fluorescent dyes and hybridized simultaneously on the same slide using a reference design with a dye swap protocol. Thirty seven-condition experiment, Non-infected control vs. Primary or secondary EA, EM, or ET infected IEL at 1 to 6. Biological replicates: 2 replicates with dye-switching from each infection groups. Two replicates per array.
2011-08-14 | E-GEOD-31213 | biostudies-arrayexpress
Project description:Non-coding sense and antisense germline transcription within the immunoglobulin heavy chain locus precedes V(D)J recombination and has been proposed to be associated with Igh locus accessibility, although its precise role remains elusive. However, no global analysis of germline transcription throughout the Igh locus has been done. Therefore, we performed directional RNAseq, demonstrating the locations and extent of both sense and antisense transcription throughout the Igh locus. Surprisingly, the majority of antisense transcripts are localized around two PAIR elements in the distal IghV region. Importantly, long-distance loops measured by 3C are observed between these two active PAIR promoters and EM-NM-<, the start site of IM-NM-< germline transcription, in a lineage- and stage-specific manner, even though this antisense transcription is EM-NM-<-independent. YY1-/- pro-B cells are greatly impaired in distal VH gene rearrangement and Igh locus compaction, and we demonstrate that YY1 deficiency greatly reduces antisense transcription and PAIR-EM-NM-< interactions. ChIP-seq shows high level YY1 binding only at EM-NM-<, but low levels near some antisense promoters. PAIR-EM-NM-< interactions are not disrupted by DRB, which blocks transcription elongation without disrupting transcription factories once they are established, but the looping is reduced after heat shock treatment, which disrupts transcription factories. We propose that transcription-mediated interactions, most likely at transcription factories, initially compact the Igh locus, bringing distal VH genes close to the DJH rearrangement, which is adjacent to EM-NM-<. Therefore, we hypothesize that one key role of non-coding germline transcription is to facilitate locus compaction, allowing distal VH genes to undergo efficient rearrangement. ChIP Seq YY1 vs. input control
2012-10-18 | E-GEOD-40822 | biostudies-arrayexpress
Project description:The viewpoints used in the 4C-seq data were either the EVI1 promoter or the MYC super-enhancer
| EGAD00001006818 | EGA
Project description:We developed a targeted chromosome conformation capture (4C) approach that uses unique molecular identifiers (UMI) to derive high complexity quantitative chromosome contact profiles with controlled signal to noise ratios. We demonstrate that the method improves the sensitivity and specificity for detection of long-range chromosomal interactions, and that it allows the design of interaction screens with predictable statistical power. UMI-4C robustly quantifies contact intensity changes between cell types and conditions, opening the way toward incorporation of long-range interactions in quantitative models of gene regulation. We constructed UMI-4C profiles of 13 different genomic loci (viewpoints) in five different cell lines, in order to study the 3D chromatin contact maps of these selected loci. The coordinates for these viewpoints are: G1p1 chrX:48646542; baitG1_3_5kb chrX:48641393; bait_50kb chrX:48595987; bait_165kb chrX:48476525; ANK1 chr8:41654693; hbb_3HS chr11:5221346; hbb_HBB chr11:5248714; hbb_HBBP1_G1 chr11:5266532; HBB_HBE chr11:5292159; HBB_HS2 chr11:5301345; HBB_HS3 chr11:5306690; HBB_HS5 chr11:5313539; HBB_HBD chr11:5256597
2016-06-15 | E-GEOD-76763 | biostudies-arrayexpress
Project description:We performed 4C-seq in the A549 cell line to investigate changes in chromatin interactions at the ZBTB16 locus. Cells were treated with either 100 nM dexamethasone or 0.1% ethanol. After 4 hours, cells were washed 2x with PBS and cultured in hormone-free medium for 24 hours, after which cells were treated again for 4 hours with either 100 nM dexamethasone or 0.1% ethanol. Experiments were performed in two biological replicates. For each treatment, 4C-seq data were generated for the following two viewpoints: ZBTB16 promoter-proximal viewpoint coordinates: chr11:113929670-113930464 (hg19) ZBTB16 intronic viewpoint coordinates: chr11:114051224-114051804 (hg19)
2021-05-03 | E-MTAB-9915 | biostudies-arrayexpress