RNA degradome analysis reveals substrates of NYN-domain containing DNE1 endoribonuclease in Arabidopsis
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
PROVIDER: GSE193247 | GEO | 2023/04/25
REPOSITORIES: GEO
Similar Datasets
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.
2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE.
2014-03-08 | GSE47121 | GEO
Project description:Application of Parallel Analysis of RNA Ends (PARE), an RNA degradome approach to identify substrates of Arabidopsis XRN4. The xrn4 mutants overaccumulate decay intermediates from multiple mRNA turnover pathways. This material is based on work supported by the National Science Foundation [under Grant Numbers MCB1021636 and MCB1817764 to P.J.G.]
2019-08-13 | GSE119706 | GEO
Project description:GMUCT 2.0 data were analyzed to globally identify 5’ ends differentially accumulated in SKI3 RNAi roots as compared with GUS RNAi, as well as those that change in abundance in response to rhizobia SUPERKILLER3 (*SKI3),* a member of SKI complex that guides RNAs to the 3 to 5' exoribonuclease of the exosome complex. In the absence of a functional SKI complex to thread transcripts to the exosome, the bulk of the mRNAs that accumulate in the cytoplasm are diverted to the 5 -to-3 XRN4 pathway for degradation. We explored the function of *SKI3* during root nodule symbiosis using RNA interference to knockdown *SKI3* in *M. truncatula* hairy roots. To evaluate whether silencing of *SKI3* in *M. truncatula* roots altered RNA decay in response to rhizobia, we performed genome-wide mapping of uncapped and cleaved transcripts (GMUCT 2.0) on *GUS* RNA and *SKI3*RNAi roots. This method identifies products of miRNA or siRNA guided-endonucleolytic cleavage as well as decapped mRNAs by selecting for molecules with a free 5 monophosphate (5 P) (Willmann et al., 2014). GMUCT 2.0 data were analyzed to globally identify 5' ends differentially accumulated in *SKI3* RNAi roots as compared with *GUS* RNAi, as well as those that change in abundance in response to rhizobia.
2022-10-01 | GSE135920 | GEO
Project description:Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0
| PRJNA203678 | ENA
Project description:Post-transcriptional gene regulation is a critical layer of overall gene expression programs and microRNAs (miRNAs) play an indispensable role in this process by guiding cleavage on the messenger RNA targets. The miRNA-guided cleavage on the mRNA targets can be confirmed by analyzing the sequenced degradome or PARE or GMUCT libraries. However, high-throughput sequencing of PARE or degradome libraries is not as straightforward as sequencing small RNA libraries. Moreover, the currently used degradome or PARE methods utilize Mme1 restriction site and the resulting fragments are only 20-nt long, which often poses difficulty in distinguishing between the family members of the same gene family. In this modified degradome protocol, EcoP15I recognition site is introduced to the 3' end of the 5’RNA adaptor of TruSeq small RNA library, the double strand DNA adaptor sequence is modified to suit with the ends generated by the EcoP15I. These modifications allow amplification of the degradome library by primer pairs used for small RNA library preparation. Therefore, degradome library generated using this protocol can be sequenced as easily as small RNA library, and the resulting tag length is ~27-nt, which is longer than previous methods (20-nt). The protocol allows sequencing small RNA and degradome libraries simultaneously.
2019-12-17 | GSE138545 | GEO
Project description:Whole genome small RNA sequencing (wild-type Col-0, abh1-1, ein5-6, ein5-6 abh1-1) and 5'-RACE (GMUCT) (wild-type Col-0 and ein5-6) sequencing of parenthetically indicated genotypes of Arabidopsis using the Illumina Genetic Analyzer. Whole-genome oligonucleotide tiling microarrays were used for gene expression studies of the entire transcriptome for wildtype Col-0, abh1-1, ein5-6, and ein5-6 abh1-1 plants. Micro (mi)RNAs and small-interfering (si)RNAs are abundant endogenous small (sm)RNAs that control transcript expression by post-transcriptional gene silencing. Here, we show that concomitant loss of XRN4/EIN5, a 5’-3’ exoribonuclease, and CBP80/ABH1, the largest subunit of the mRNA cap binding complex, results in Arabidopsis plants manifesting myriad developmental defects. Through the analysis of ein5 abh1 double mutant plants, we find that CBP80/ABH1 regulates the levels of mature miRNAs, which suggests this protein is a novel component of the miRNA-mediated RNA silencing pathway. Additionally, we show that a novel class of smRNAs are processed from both sense and anti-sense strands of ~130 endogenous transcripts that apparently are converted to double-stranded RNA and subsequently processed into smRNAs, and accumulate in the absence of XRN4/EIN5. Moreover, we demonstrate that accumulation of these smRNAs is often synergistically increased in ein5 abh1 double mutant plants, which suggests that these proteins act coordinately to regulate the substrates from which they are processed. Finally, we find that the parent transcripts of these novel smRNAs accumulate in an uncapped form upon loss of XRN4/EIN5. These results suggest that uncapped endogenous transcripts can shuttle into an RNA silencing pathway where they become smRNA biogenesis substrates. Overall, our results reveal unexpected connections between RNA metabolism and silencing. Keywords: transcriptome analysis using tiling array; whole genome small RNA sequencing; 5'-RACE sequencing
2008-05-15 | GSE11070 | GEO
Project description:PARE (parallel analysis of RNA ends) was performed to study the change of uncapped mRNAs before and after cold treatment in Brachypodium. Different change patterns were identified. We have provided a complete view of uncapped transcriptome under cold stress condition, which will deepen our understanding of gene expression regulation in cold stress response as well as cold stress response mechanism for monocot plants. The uncapped mRNA profiles of 12-day-old Brachypodium seedlings with and without cold treatment (4 M-BM-0C for 24 h) were generated by deep sequencing using Illumina GAIIx
2013-07-15 | E-GEOD-48234 | biostudies-arrayexpress
Project description:Deep sequencing of the 5' ends of uncapped, polyA-enriched mRNA from the moss Physcomitrella patens was performed (e.g. "degradome sequencing"). This GEO record contains all genome-matched and/or transcriptome-matched processed 24nt tags, representing the 5' ends of uncapped messages. These data were used to 1) discover microRNA targets and 2) to examine patterns of MIRNA hairpin cleavage.
2009-10-01 | GSE16367 | GEO
Project description:PARE (parallel analysis of RNA ends) was performed to study the change of uncapped mRNAs before and after cold treatment in Brachypodium. Different change patterns were identified. We have provided a complete view of uncapped transcriptome under cold stress condition, which will deepen our understanding of gene expression regulation in cold stress response as well as cold stress response mechanism for monocot plants.
2013-07-15 | GSE48234 | GEO