Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA203678 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR863540.fastq.gz | Fastqsanger.gz | |||
| SRR863541.fastq.gz | Fastqsanger.gz | |||
| SRR863542.fastq.gz | Fastqsanger.gz | |||
| SRR863543.fastq.gz | Fastqsanger.gz | |||
| SRR863544.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 10 |
Similar Datasets
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.
2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE.
2014-03-08 | GSE47121 | GEO
Project description:We were interested in identifying targets of novel putative miRNAs we identified from small RNA sequencing libraries of Arabidopsis shoots. The small RNA (smRNA) sequencing libraries were made to identify changes in abundance of specific smRNAs in response to developmental transitions in Arabidopsis thaliana shoots, with special focus on vegetative phase change. We specifically wanted to separate the temporal changes in gene expression that result from vegetative phase change and those from flowering. Because of the close timing between the juvenile-to-adult and adult-to-reproductive developmental transitions in Arabidopsis grown under long day conditions, we used the late-flowering genotype FRI;FLC developed by the lab of Richard Amasino by introgressing the FRI allele from Sf-2 into the Col-0 genetic background, which is fri;FLC. For the early flowering genotype, we used FRI;flc-3, also developed by the Amasino lab by EMS-mutagenizing FRI;FLC, identifying early flowering mutants, and backcrossing multiple times to eliminate other EMS-induced mutations. The onset of vegetative phase change in FRI;FLC and FRI;flc-3 under our growth conditions was identical, but the progression was slower in FRI;FLC. By sequencing small RNAs from shoot apices at different time points and fully-expanded leaves at different positions on the shoot and comparing the results between the two genotypes, we were able to obtain a clear picture of changes in small RNA abundance in response to vegetative phase change and flowering in Arabidopsis. We then used the remaining RNA to make genome-wide mapping of uncapped and cleaved transcripts (GMUCT) 2.0 libraries of a subset of our samples. GMUCT 2.0 allows you to identify RNAs that are 1) uncapped and in the process of 5’->3’ exonuclease degradation and 2) miRNA and siRNA-mediated cleavage products. We wanted to use these GMUCT 2.0 libraries to identify targets of novel putative miRNAs discovered by our smRNA sequencing, thereby supporting the idea that these novel putative miRNAs are in fact functional.
2016-02-01 | GSE72505 | GEO
Project description:To gain insight into the functional role of DNE1 in cytoplasmic mRNA decay, we performed Parallel Analysis of RNA Ends (PARE) and Global Mapping of Uncapped and Cleaved Transcripts (GMUCT) analysis to identify DNE1-dependent cleavage sites based on their sensitivity to XRN4 within the Arabidopsis transcriptome
2023-04-25 | GSE193247 | GEO
Project description:GMUCT 2.0 data were analyzed to globally identify 5’ ends differentially accumulated in SKI3 RNAi roots as compared with GUS RNAi, as well as those that change in abundance in response to rhizobia SUPERKILLER3 (*SKI3),* a member of SKI complex that guides RNAs to the 3 to 5' exoribonuclease of the exosome complex. In the absence of a functional SKI complex to thread transcripts to the exosome, the bulk of the mRNAs that accumulate in the cytoplasm are diverted to the 5 -to-3 XRN4 pathway for degradation. We explored the function of *SKI3* during root nodule symbiosis using RNA interference to knockdown *SKI3* in *M. truncatula* hairy roots. To evaluate whether silencing of *SKI3* in *M. truncatula* roots altered RNA decay in response to rhizobia, we performed genome-wide mapping of uncapped and cleaved transcripts (GMUCT 2.0) on *GUS* RNA and *SKI3*RNAi roots. This method identifies products of miRNA or siRNA guided-endonucleolytic cleavage as well as decapped mRNAs by selecting for molecules with a free 5 monophosphate (5 P) (Willmann et al., 2014). GMUCT 2.0 data were analyzed to globally identify 5' ends differentially accumulated in *SKI3* RNAi roots as compared with *GUS* RNAi, as well as those that change in abundance in response to rhizobia.
2022-10-01 | GSE135920 | GEO
Project description:Genome-wide mapping of uncapped and cleaved transcripts (GMUCT) and transcriptome of DCLs
| PRJNA292107 | ENA
Project description:The identificantion of novel miRNA targets in Arabidopsis thaliana shoots using genome-wide mapping of uncapped and cleaved transcripts (GMUCT) 2.0
| PRJNA294285 | ENA
Project description:Positional proteomics methodologies have transformed protease research and have brought mass spectrometry (MS)-based degradomics studies to the forefront of protease characterization and system-wide interrogation of protease signaling. Considerable advancements in sensitivity and throughput of liquid chromatography (LC)-MS/MS instrumentation enable generation of enormous positional proteomics datasets of protein termini and neo-termini of cleaved protease substrates. However, such progress has not been observed to the same extent in data analysis and post-processing steps, which arguably constitute the largest bottleneck in positional proteomics workflows. Here, we present a computational tool, CLIPPER 2.0, that builds on prior algorithms developed for MS-based protein termini analysis, facilitating peptide level annotation and data analysis. CLIPPER 2.0 can be used with several sample preparation workflows and proteomics search algorithms, and enables fast and automated database information retrieval, statistical and network analysis, as well as visualization of terminomic datasets. We demonstrate our tool by analyzing GluC and MMP9 cleavages in HeLa lysates. CLIPPER 2.0 is available at https://github.com/UadKLab/CLIPPER-2.0.
2024-05-02 | PXD047261 | Pride