Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome-wide N6-Methyladenosine (m6A) modifications in Anopheles sinensis

ABSTRACT: We profile transcriptome-wide m6A in female and male Anopheles sinensis and reveal that m6A is also a highly conserved modification of mRNA in mosquitoes were generated by deep sequencing, in triplicate, using illumina Novaseq™ 6000. Distinct from mammals and yeast, but similar to Arabidopsis thaliana, m6A in An. sinensis is enriched not only around the stop codon and within 3’-untranslated regions, but also around the start codon and 5’-UTR. Gene ontology analysis indicates that the unique distribution pattern of m6A in An. sinensis is associated with mosquito sex-specific pathways. In addition, the positive correlation between m6A deposition and mRNA abundance indicates that m6A can play roles in regulating gene expression in mosquitoes. Our study proposed a transcriptional regulatory network of m6A in An. sinensis, which may provide a new clue for the control of this disease-transmitting vector.

ORGANISM(S): Anopheles sinensis

PROVIDER: GSE193379 | GEO | 2022/05/18

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

microRNA profile of adult female Anopheles sinensis

Project description:We investigate the global miRNA expression profile of An. sinensis using illumine Hiseq 2000 sequencing.The annotation and prediction of miRNAs lays the foundation for the further functional study of An. sinensis miRNAs and will facilitate their application in vector control.

2018-09-27 | GSE109005 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

Clonorchis sinensis (C. sinensis) infection remodels the chromatin accessibility of hepatocellular carcinoma

Project description:Background: Liver cancer is the third deadliest type of cancer, posing a serious threat to human health. Hepatocellular carcinoma (HCC) is the most common type of primary liver cancer. C. sinensis, classified as a definite group I carcinogen by the IARC (International Agency for Research on Cancer), is an important risk factor for HCC. Although many studies have shown that C. sinensis infection affects the prognosis of HCC patients, the specific mechanisms are still unclear, especially the dynamics and regulatory roles of chromatin accessibility. Results: In this study, we integrated ATAC-seq, RNA-seq, and ChIP-seq data to elucidate changes in the epigenetics of HCC after the C. sinensis infection. Many different accessibility regions (DARs) were identified both in tumors and adjacent tissue after the C. sinensis infection. Meanwhile, top TFs whose motifs were enriched in DAR were found, such as HNF4a, FOXI1, etc. Although there were slight deviations, epigenetic changes were found to be consistent with gene expression levels. We also revealed that H3K9ac, H3K4me2, H3K4me3, H3K27ac, and H3K4me1 were associated with chromatin accessibility. Importantly, we also found potential evidence that C. sinensis infection would alter the spatial structure of the HCC genome. Finally, both molecular experimental results and clinical data certified that C. sinensis infection would promote the metastasis of HCC. Conclusions: C. sinensis infection will remodel the chromatin accessibility of HCC, leading to changes in gene expression levels. This study provides conclusive evidence that C. sinensis infection alters the epigenetics of HCC.

2024-11-26 | GSE276855 | GEO

Anopheles sinensis

Project description:Anopheles sinensis overview

| PRJNA79041 | ENA

Anopheles sinensis

Project description:Anopheles sinensis Genome sequencing

| PRJNA78949 | ENA

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Anopheles sinensis

Project description:Anopheles sinensis Raw sequence reads

| PRJNA786658 | ENA

Anopheles sinensis

Project description:Anopheles sinensis adult female sialotranscriptome

| PRJNA321832 | ENA

Anopheles sinensis

Project description:Anopheles sinensis Transcriptome or Gene expression

| PRJNA196809 | ENA

Anopheles sinensis

Project description:The transcriptome sequencing of Anopheles sinensis