RNA-Seq analysis of the gene expression profile of wild type and dRassf mutant flies after infection by Flock House Virus
Ontology highlight
ABSTRACT:
ORGANISM(S): Drosophila melanogaster
PROVIDER: GSE194117 | GEO | 2022/07/29
REPOSITORIES: GEO
Similar Datasets
Project description:BackgroundEbola virus (EBOV) infection results in high morbidity and mortality and is primarily transmitted in communities by contact with infectious bodily fluids. While clinical and experimental evidence indicates that EBOV is transmitted via mucosal exposure, the ability of non-biting muscid flies to mechanically transmit EBOV following exposure to the face had not been assessed.ResultsTo investigate this transmission route, house flies (Musca domestica Linnaeus) were used to deliver an EBOV/blood mixture to the ocular/nasal/oral facial mucosa of four cynomolgus macaques (Macaca fascicularis Raffles). Following exposure, macaques were monitored for evidence of infection through the conclusion of the study, days 57 and 58. We found no evidence of systemic infection in any of the exposed macaques.ConclusionsThe results of this study indicate that there is a low potential for the mechanical transmission of EBOV via house flies - the conditions in this study were not sufficient to initiate infection.
| S-EPMC5415731 | biostudies-literature
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro.
2015-04-06 | GSE64911 | GEO
Project description:Across metazoans, innate immunity is vital in defending organisms against viral infection. In mammals, antiviral innate immunity is orchestrated by interferon signaling, activating the STAT transcription factors downstream of the JAK kinases to induce expression of antiviral effector genes. In the nematode C. elegans, which lacks the interferon system, the major antiviral response so far described is RNA interference but whether additional gene expression responses are employed is not known. Here we show that, despite the absence of both interferon and JAK, the C. elegans STAT homologue STA-1 orchestrates antiviral immunity. Intriguingly, mutants lacking STA-1 show increased resistance to antiviral infection. Using gene expression analysis and chromatin immunoprecipitation we show that, in contrast to the mammalian pathway, STA-1 acts as a transcriptional repressor. Thus STA-1 might act to suppress a constitutive antiviral response in the absence of infection. Using a reverse genetic screen we identify the SID-3 as a kinase upstream of STA-1 in the response to infection. Together, our work identifies a novel STAT regulatory cascade controlling its activity in antiviral resistance, illustrating the complex evolutionary trajectory displayed by innate immune signaling pathways across metazoan organisms.
2017-08-11 | GSE95229 | GEO
Project description:Across metazoans, innate immunity is vital in defending organisms against viral infection. In mammals, antiviral innate immunity is orchestrated by interferon signaling, activating the STAT transcription factors downstream of the JAK kinases to induce expression of antiviral effector genes. In the nematode C. elegans, which lacks the interferon system, the major antiviral response so far described is RNA interference but whether additional gene expression responses are employed is not known. Here we show that, despite the absence of both interferon and JAK, the C. elegans STAT homologue STA-1 orchestrates antiviral immunity. Intriguingly, mutants lacking STA-1 show increased resistance to antiviral infection. Using gene expression analysis and chromatin immunoprecipitation we show that, in contrast to the mammalian pathway, STA-1 acts as a transcriptional repressor. Thus STA-1 might act to suppress a constitutive antiviral response in the absence of infection. Using a reverse genetic screen we identify the SID-3 as a kinase upstream of STA-1 in the response to infection. Together, our work identifies a novel STAT regulatory cascade controlling its activity in antiviral resistance, illustrating the complex evolutionary trajectory displayed by innate immune signaling pathways across metazoan organisms.
2017-08-11 | GSE95228 | GEO
Project description:Study was performed in order to determine the scope of antiviral response of Rousettus aegyptiacus-derived fibroblasts to Sendai and Marburg virus infection. This study aids in understanding the function of the expanded immune repertoire of Rosettus aegyptiacus.
2018-11-01 | GSE117367 | GEO
Project description:Viruses are obligate intracellular parasites that exploit the host metabolic machineries to meet their extraordinary biosynthetic demands. Integrative transcriptomic and lipidomic profiling confirmed that Middle East respiratory syndrome coronavirus (MERS-CoV) infection reprograms the host lipid metabolism. By exploring a bioactive lipid library, we identified a tool compound, AM580 which is highly potent in interrupting the life cycle of diverse viruses including MERS-CoV and influenza A virus.</br> Using click chemistry, the sterol regulatory element binding protein (SREBP) was identified as the primary cellular target of AM580 which accounts for its broad-spectrum antiviral activity. Mechanistic studies pinpoint multiple SREBP proteolytic processes and SREBP-regulated lipid biosynthesis pathways, including the downstream viral protein palmitoylation and double-membrane vesicles formation, that are indispensable for virus replication. Collectively, our study identifies a basic lipogenic transactivation event with broad relevance to human viral infections and represents SREBP as an ideal target for the development of broad-spectrum intervention strategies.
2018-11-26 | MTBLS762 | MetaboLights
Project description:BackgroundSevere acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a recently emerged coronavirus that is the causative agent of the coronavirus disease 2019 (COVID-19) pandemic. COVID-19 in humans is characterized by a wide range of symptoms that range from asymptomatic to mild or severe illness including death. SARS-CoV-2 is highly contagious and is transmitted via the oral-nasal route through droplets and aerosols, or through contact with contaminated fomites. House flies are known to transmit bacterial, parasitic and viral diseases to humans and animals as mechanical vectors. Previous studies have shown that house flies can mechanically transmit coronaviruses, such as turkey coronavirus; however, the house fly's role in SARS-CoV-2 transmission has not yet been explored. The goal of this work was to investigate the potential of house flies to mechanically transmit SARS-CoV-2. For this purpose, it was determined whether house flies can acquire SARS-CoV-2, harbor live virus and mechanically transmit the virus to naive substrates and surfaces.MethodsTwo independent studies were performed to address the study objectives. In the first study, house flies were tested for infectivity after exposure to SARS-CoV-2-spiked medium or milk. In the second study, environmental samples were tested for infectivity after contact with SARS-CoV-2-exposed flies. During both studies, samples were collected at various time points post-exposure and evaluated by SARS-CoV-2-specific RT-qPCR and virus isolation.ResultsAll flies exposed to SARS-CoV-2-spiked media or milk substrates were positive for viral RNA at 4 h and 24 h post-exposure. Infectious virus was isolated only from the flies exposed to virus-spiked milk but not from those exposed to virus-spiked medium. Moreover, viral RNA was detected in environmental samples after contact with SARS-CoV-2 exposed flies, although no infectious virus was recovered from these samples.ConclusionsUnder laboratory conditions, house flies acquired and harbored infectious SARS-CoV-2 for up to 24 h post-exposure. In addition, house flies were able to mechanically transmit SARS-CoV-2 genomic RNA to the surrounding environment up to 24 h post-exposure. Further studies are warranted to determine if house fly transmission occurs naturally and the potential public health implications of such events.
| S-EPMC8056201 | biostudies-literature
Project description:Small RNAs were profiled during Sendai virus infection of human A549 cells to identify changes in microRNA abundance during the cellular antiviral response. Examination of microRNA abundance during Sendai virus infection.
2013-06-10 | E-GEOD-43966 | biostudies-arrayexpress
Project description:Apoptosis is required not only for proper morphogenesis and tissue size regulation during development, but also for removing damaged or unwanted cells to maintain homeostasis. Apoptosis is mainly executed by evolutionally-conserved signaling process including caspases and its activator, dark. We performed microarray analysis of darkcd4 mutant flies to reveal the changes in gene expression. We found the elevated immune reaction, suggesting that inflammatory response was triggered by necrosis in darkcd4 .
2014-06-26 | GSE47853 | GEO