Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Senataxin and RNase H2 act redundantly to suppress genome instability during class switch recombination

ABSTRACT: Class switch recombination generates antibody distinct isotypes critical to a robust adaptive immune system and defects are associated with auto-immune disorders and lymphomagenesis. Transcription is required during class switch to recruit the cytidine deaminase AID—an essential step for the formation of DNA doublestrand breaks—and strongly induces the formation of R loops within the immunoglobulin heavy chain locus. However, the impact of R loops on double-strand break formation and repair during class switch recombination remains unclear. Here we report that cells lacking two enzymes involved in R loop removal— Senataxin and RNase H2—exhibit increased R loop formation and genome instability at the immunoglobulin heavy chain locus without impacting class switch recombination efficiency, transcriptional activity, or AID recruitment. Senataxin and RNase H2-deficient cells also exhibit increased insertion mutations at switch junctions, a hallmark of alternative end joining. Importantly, these phenotypes were not observed in cells lacking Senataxin or RNase H2B alone. We propose that Senataxin acts redundantly with RNase H2 to mediate timely R loop removal, promoting efficient repair while suppressing AID-dependent genome instability and insertional mutagenesis.

ORGANISM(S): Mus musculus

PROVIDER: GSE201210 | GEO | 2022/12/14

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Senataxin and RNase H2 act redundantly to suppress genome instability during class switch recombination

Project description:Senataxin and RNase H2 act redundantly to suppress genome instability during class switch recombination

| PRJNA830361 | ENA

YY1 Controls Em-3’RR DNA Loop Formation and Immunoglobulin Heavy Chain Class Switch Recombination.

Project description:Activation of splenic B cells induces formation of a 220kb DNA loop between Em and 3’RR enhancers in the immunoglobulin heavy chain locus (IgH). This DNA loop has been proposed to be necessary for the crucial immune diversification mechanism of IgH class switch recombination, but the factors that control its formation are unknown. We show that conditional deletion of transcription factor YY1 in primary splenic B cells results in a dramatic drop in formation of this DNA loop, as well as immunoglobulin class switch recombination. Reconstitution of YY1-deleted splenic B cells with various YY1 mutants showed that the C-terminal half of YY1 lacking the transactivation domain restored both Em-3’RR DNA loop formation as well as class switch recombination. RNA transcript analyses of YY1 conditional deleted splenic B cells suggest that YY1 does not regulate genes needed for DNA looping or CSR. Our results argue for a direct physical mechanism of YY1 mediating long-distance DNA loops and provide strong evidence of the importance of this DNA loop for class switching. Our results provide foundational mechanistic insight into a crucial immune function.

2016-08-06 | GSE85259 | GEO

YY1 Controls Em-3â??RR DNA Loop Formation and Immunoglobulin Heavy Chain Class Switch Recombination.

Project description:Activation of splenic B cells induces formation of a 220kb DNA loop between Em and 3â??RR enhancers in the immunoglobulin heavy chain locus (IgH). This DNA loop has been proposed to be necessary for the crucial immune diversification mechanism of IgH class switch recombination, but the factors that control its formation are unknown. We show that conditional deletion of transcription factor YY1 in primary splenic B cells results in a dramatic drop in formation of this DNA loop, as well as immunoglobulin class switch recombination. Reconstitution of YY1-deleted splenic B cells with various YY1 mutants showed that the C-terminal half of YY1 lacking the transactivation domain restored both Em-3â??RR DNA loop formation as well as class switch recombination. RNA transcript analyses of YY1 conditional deleted splenic B cells suggest that YY1 does not regulate genes needed for DNA looping or CSR. Our results argue for a direct physical mechanism of YY1 mediating long-distance DNA loops and provide strong evidence of the importance of this DNA loop for class switching. Our results provide foundational mechanistic insight into a crucial immune function. Follicular B cells were isolated from the spleens of three C57Bl/6 yy1 fl/fl mice. For each spleen, half the cells received mock treatment and half received TATCRE. The 6 samples were then grown in RPMI medium along with LPS, Il4, OPI, and 20% FBS for 72 hours. The 6 groups of cells were lysed and RNA was isolated for library preparation. Expression differences between Mock and TATCRE treated cells were determined to understand the role of yy1 in B cell class switching.

2016-08-06 | E-GEOD-85259 | biostudies-arrayexpress

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Mus musculus

Project description:YY1 Controls Em-3’RR DNA Loop Formation and Immunoglobulin Heavy Chain Class Switch Recombination.

| PRJNA337963 | ENA

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

2016-02-17 | GSE62969 | GEO

Acetylated Histone Reader Brd4 functions as Repair Adaptor in Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a B cell specific genomic alteration induced by activation induced cytidine deaminase (AID)-dependent DNA break, followed by repair and recombination at the immunoglobulin heavy-chain locus. The involvement of several chromatin-associated factors in promoting AID-induced DNA break formation has been reported. However, the involvement of chromatin adaptors at the repair phase of CSR remains unknown. Here, we provide evidence that acetylated histone reader Brd4 is critical to the repair and recombination step of CSR. Brd4 was recruited to the AID-induced DNA break region, and depletion of Brd4 from the S region chromatin by knockdown or a chemical inhibitor JQ1 causes CSR impairment without affecting AID-induced DNA break generation. Such inhibition of Brd4 suppressed the accumulation of 53BP1 and UNG at the cleaved S regions, perturbed switch donor-switch acceptor microhomology length and reduced Igh/c-myc translocation. We conclude that Brd4 serves as a histone-reader platform required for the recruitment of CSR repair components.

2014-06-20 | GSE52239 | GEO

Acetylated Histone Reader Brd4 functions as Repair Adaptor in Immunoglobulin Class Switch Recombination

2014-06-20 | E-GEOD-52239 | biostudies-arrayexpress

RNA-sequencing of Nedd4+/+ and Nedd4-/- mouse splenic B cells

Project description:Programmed mutagenesis of the immunoglobulin locus of B-lymphocytes during class switch recombination and somatic hypermutation requires RNA polymerase II (RNA polII) transcription complex dependent targeting of the DNA mutator, Activation Induced cytidine Deaminase (AID). AID deaminates cytidine residues on substrate sequences in the immunoglobulin (Ig) locus via a transcription-dependent mechanism and this activity is stimulated by the RNA polII stalling co-factor Spt5 and the eleven-subunit cellular non-coding RNA 3’-5’ exonucleolytic processing complex, RNA exosome. The mechanism by which the RNA exosome recognizes immunoglobulin locus RNA substrates to stimulate AID DNA deamination activity on its in vivo substrate sequences is an important question. Here we report that E3-ubiquitin ligase Nedd4 destabilizes AID-associated RNA polII by a ubiquitination event leading to generation of 3’-end free RNA exosome RNA substrates at the Ig locus and other AID target sequences genome-wide. Using highthrough-out RNA sequencing technology, we find that lack of Nedd4 activity in B cells leads to accumulation of RNA exosome substrates at AID target genes. Moreover, we find that Nedd4-deficient B cells are inefficient in undergoing class switch recombination. Taken together, our study links non-coding RNA processing following RNA polymerase II pausing with regulation of the mutator AID protein. Our study also identifies Nedd4 as a regulator of non-coding RNA that are generated by stalled RNA polII genome-wide. Splenic B cells from Nedd4+/+ and Nedd4-/- B cells fetal liver chimeric mice were were stimulated in culture for IgG1 CSR. Total RNA was isolated and evaluated with whole genome RNA-seq

2013-08-07 | E-GEOD-49027 | biostudies-arrayexpress

Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to switch regions and by the subsequent generation and resolution of dsDNA breaks (DSBs). During, CSR the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and switch regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we show that during CSR, AID associates with subunits of cohesin, a complex previously implicated in DNA repair and in the formation of DNA loops between enhancers and promoters. By ChIP-Seq experiments, we find that Cohesin is dynamically recruited to the IgH locus during CSR and that knockdown of Cohesin or its regulatory subunits results in impaired CSR and abnormal DSB resolution. Our results are consistent with a model in which Cohesin controls the formation of long-range DNA loops at the IgH locus and the resolution of DSBs generated during CSR. Smc1, Smc3 and CTCF were immunoprecipitated from resting or in vitro activated B cells.

2013-10-11 | E-GEOD-43594 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data