Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The effect of TuMV on translation initiation in Arabidopsis

ABSTRACT: Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.]

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE20278 | GEO | 2011/03/11

SECONDARY ACCESSION(S): PRJNA125369

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

The effect of TuMV on translation initiation in Arabidopsis

Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.] pathogen infection: TuMV inoculated - RNA fraction: polysomal RNA(3-replications); pathogen infection: TuMV inoculated - RNA fraction: total RNA(3-replications); pathogen infection: mock inoculated - RNA fraction: polysomal RNA(3-replications); pathogen infection: mock inoculated - RNA fraction: total RNA(3-replications)

2011-03-11 | E-GEOD-20278 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis

Project description:Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis This study constructed and sequenced two independent small RNA libraries from the upper uninoculated leaves of (i) WT Arabidopsis plants 14 d after mock inoculation and of (ii) rdr1 rdr6 plants 14 d after infection with Fny CMV-Δ2b, and one library each from the upper uninoculated leaves of (iii) WT, (iv) rdr1, and (v) rdr6 plants 14 d after infection with TuMV-GFP. Coimmunoprecipitation with FLAG- and HA-specific antibodies was used to obtain (vi,vii) AGO1 and (viii,ix) AGO2 complexes, respectively, from the FLAG-AGO1/ago1-36 and HA-AGO2 plants 14 d after infection with Fny CMV-Δ2b for extracting total loaded small RNAs for the construction and sequencing of small RNA libraries.

2014-08-30 | E-GEOD-60929 | biostudies-arrayexpress

Tobacco mosaic virus infection alters phloem associated translatomes in Arabidopsis thaliana

Project description:In this study we used vascular specific promoters and a translating ribosome affinity purification strategy to identify phloem-associated translatome responses to infection by tobacco mosaic virus (TMV) in the systemic host Arabidopsis thaliana ecotype Shahdara. Three different promoter:FLAG-RPL18 lines were used. These included two phloem specific promoters (pSUC2 and pSULTR2;2) as well as the more ubiquitously expressed cauliflower mosaic virus 35S promoter (p35S). Immunopurification of ribosome-mRNA complexes was accomplished by the method described in Reynoso et al. (Plant Functional Genomics: Methods and Protocols, 185-207; 2015). The dataset includes samples from the leaves of 5-week-old plants inoculated with TMV (1 mg/mL) or mock inoculated with sterile water.

2017-07-17 | GSE97662 | GEO

Tobacco mosaic virus infection alters phloem associated translatomes in Nicotiana benthamiana

Project description:In this study we used vascular specific promoters and a translating ribosome affinity purification strategy to identify phloem-associated translatome responses to infection by tobacco mosaic virus (TMV) in the systemic host Nicotiana benthamiana. Three different promoter:FLAG-RPL18 lines were used. These included two phloem specific promoters (pSUC2 and pSULTR2;2) as well as the more ubiquitously expressed cauliflower mosaic virus 35S promoter (p35S). Immunopurification of ribosome-mRNA complexes was accomplished by the method described in Reynoso et al. (Plant Functional Genomics: Methods and Protocols, 185-207; 2015). The dataset includes samples from the leaves of 5-week-old plants inoculated with TMV (1 mg/mL) or mock inoculated with sterile water.

2017-07-17 | GSE97663 | GEO

Correlation Analysis of Expression Profile and Quantitative iTRAQ-LC-MS/MS Proteomics Reveals Resistance Mechanism Against TuMV in Chinese Cabbage (Brassica rapa ssp. pekinensis)

Project description:To better examine the molecular mechanisms behind the virus infection, we conducted a correlation analysis of RNA-Seq and quantitative iTRAQ-LC-MS/MS in TuMV-infected and in healthy Chinese cabbage leaves.

2020-08-07 | GSE151932 | GEO

Label-free quantitative proteomics on Nicotiana benthamiana plasmodesmal proteome following viral infection

Project description:We analyzed the PD-enriched fraction from Turnip mosaic virus (TuMV)-infected Nicotiana benthmiana (N. benthamiana) by using label-free quantitative proteomics of which 100 and 48 were significantly increased and decreased respectively when compared with mock plants.

2017-10-19 | PXD006323 | Pride

Arabidopsis thaliana strain:Landsberg erecta Transcriptome or Gene expression

Project description:To study cell type-specific gene expression in the leaf boundary region in the genome scale, we employed the TRAP-seq approach recently implemented. In brief, we introduced a reporter line carrying the fusion of the large subunit ribosomal protein L18 with N-terminal His and FLAG epitope tags (HF-RPL18) under the control of the pOp promoter into driver lines expressing the chimeric TF LhG4 under the control of the LATERAL SUPPRESSOR (LAS) promoter, and under the control of the ASYMMETRIC LEAVES1 (AS1) promoter. These driver lines were chosen because pLAS::LhG4 has boundary region-specific activity (Goldshmidt et al, 2008), and pAS1::LhG4 drives pOp reporter expression throughout emerging leaf primordia, but not in the SAM. Cell type-specific expression of HF-RPL18 can efficiently incorporate epitope tags into polysomes for immunopurification of all translating cellular mRNAs. We immunopurified polysomes from seedlings at 7 days after germination (DAG), to isolate translating mRNA in the LAS-expressing organ boundary cells and AS1-expressing leaf primordia and cotyledon cells. Then, we used deep sequencing to map and quantify these mRNA samples.

2015-02-07 | E-MTAB-4423 | biostudies-arrayexpress

Temporal transcriptomic analysis of the Arabidopsis thaliana - Botrytis cinerea interaction

Project description:Transcriptional profiling of Arabidopsis leaves comparing mock-treated leaves with Botrytis cinerea infected leaves over a time-course (12 and 24 hrs).

2011-03-01 | GSE24445 | GEO