Dataset Information

Simultaneous multifunctional transcriptome engineering by CRISPR RNA scaffold

ABSTRACT: RNA processing and metabolism are subjected to precise regulation in the cell to ensure integrity and functions of RNA. Though targeted RNA engineering has become feasible with the discovery and engineering of the CRISPR-Cas13 system, simultaneous modulation of different RNA processing steps remains unavailable. In addition, the off-target events resulting from the effectors fused with dCas13 limit its application. Here we developed a novel platform, Combinatorial RNA Engineering via Scaffold Tagged gRNA (CREST), which can simultaneously execute multiple RNA modulation functions on different RNA targets. In CREST, RNA scaffolds are appended to the 3’ end of Cas13 gRNA and their cognate RNA binding proteins are fused with enzymatic domains for manipulation. We show that CREST is capable of simultaneously manipulating RNA alternative splicing and A-to-G or C-to-U base editing. Furthermore, by fusing two split fragments of the deaminase domain of ADAR2 to dCas13 and PUFc respectively, we reconstituted its enzyme activity at target sites. This split design can reduce more than 90% of off-target events otherwise induced by a full-length effector. The flexibility of the CREST framework will enrich the transcriptome engineering toolbox for the study of RNA biology and the development of RNA-focused therapeutics

ORGANISM(S): Homo sapiens

PROVIDER: GSE206745 | GEO | 2022/06/26

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Simultaneous multifunctional transcriptome engineering by CRISPR RNA scaffold

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets