Effects of oocyte-specific PIK3CA* transgene knock-in in ovaries
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE233313 | GEO | 2023/12/31
REPOSITORIES: GEO
Similar Datasets
Project description:Effects of oocyte-specific PIK3CA* transgene knock-in in ovaries
| PRJNA975861 | ENA
Project description:Ovulation requires sequential molecular events and structural remodeling in the ovarian follicle for the successful release of a mature oocyte capable of being fertilised. Critical to this process is progesterone receptor (PGR), a transcription factor highly yet transiently expressed in granulosa cells of preovulatory follicles. Progesterone receptor knockout (PRKO) mice are anovulatory, with a specific and complete defect in follicle rupture. Therefore, this model was used to examine the critical molecular and biochemical mechanisms necessary for successful ovulation. Although PGR is not expressed in the cumulus cells or oocyte of the preovulatory cumulus oocyte complex (COC), it is well known that the COC responds to the cascade of gene expression changes that occurs in preovulatory granulosa cells. We used microarrays to identify putative ‘ovulation’ genes in preovulatory COCs at a time when PGR expression is maximal in granulosa cells (eCG + 8h hCG) and the preovulatory COC and follicle are undergoing the final changes necessary for successful ovulation.
2018-04-20 | GSE92436 | GEO
Project description:The reproductive lifespan in mammals is largely determined by the abundance and quality of oocytes residing within the primoridial ovarian follicular pool. Critical oocyte-expressed genes driving ovarian function have been identified, buta role for post-translational modifications, such as SUMOylation of these key factors is not well understood. Oocyte-specific genetic ablation of the sole E2 SUMOylation enzyme, UBC9, cause female sterility. Preantral and antral stage ovarian follicles are depleted by sexual maturity, and loss of the ovarian reserve in early adulthood causes premature ovarian failure, a condition associated with infertility in women. Gene expression changes indicate atered function of multiple POI candidate genes, including the transcription factors, NOBOX and SOHLH1. Together, these studies show that SUMOylation is required in the mammalian oocyte for regulating key genetic determinants of oocyte growth and differentiation.
2019-11-15 | GSE133179 | GEO
Project description:Autophagy is a cellular and energy homeostatic mechanism that contributes to maintain the number of primordial follicles, germ cell survival, and anti-ovarian aging. However, it remains unknown whether autophagy in granulosa cells affects the oocyte maturation. Here, we show a clear tendency of reduced autophagy level in human granulosa cell from women of advanced maternal age, implying a potential negative correlation between autophagy level and oocyte quality. We therefore established a co-culture system and show that either pharmacological inhibition or genetic ablation of autophagy in granulosa cells negatively affect the oocyte quality and fertilization ability. Moreover, our metabolomics analysis indicates that the adverse impact of autophagy impairment on oocyte quality is mediated by downregulated citrate levels, while exogenous supplementation of citrate can significantly restore the oocyte maturation. In molecular level, we found ATP citrate lyase (Acly), which is a crucial enzyme catalyzing the cleavage of citrate, was preferentially associated with K63-linked ubiquitin chains and recognized by the autophagy receptor protein SQSTM1/p62 for the selective autophagic degradation. In human follicles, autophagy levels in granulosa cells was downregulated with maternal aging, accompanied by decreased citrate in the follicular fluid, implying a potential correlation between citrate metabolism and oocyte quality. We also show that elevated citrate levels in porcine follicular fluid promote oocyte maturation. Collectively, our data reveal that autophagy in granulosa cells is a beneficial mechanism to maintain a certain degree of citrate by selectively targeting Acly during oocyte maturation.
2023-01-09 | GSE190697 | GEO
Project description:It is known that granulosa cells (GCs) mediate gonadotropin-induced oocyte meiosis resumption by releasing EGF-like factors in mammal, however, the detail molecular mechanisms remain unclear. Here, we demonstrate that luteinizing hormone (LH) surge induced histone deacetylase 3 (HDAC3) downregulation in GCs is essential for oocyte maturation. Before the LH surge, HDAC3 is highly expressed in GCs. Transcription factors, such as FOXO1, mediates recruitment of HDAC3 to the amphiregulin (Areg) promoter, which suppresses AREG expression. With the LH surge, decreased HDAC3 in GCs enables histone H3K14 acetylation and binding of the SP1 transcription factor to the Areg promoter to initiate AREG transcription and oocyte maturation. Conditional knockout of Hdac3 in granulosa cells in vivo or inhibition of HDAC3 activity in vitro promotes the maturation of oocytes independent of LH. Taking together, HDAC3 in GCs within ovarian follicles acts as a negative regulator of EGF-like growth factor expression before the LH surge.
2019-11-17 | GSE139665 | GEO
Project description:The mechanisms of oocyte meiotic defects and low competence during ovarian aging remains elusive for decades. Using Hi-C (genome-wide chromatin conformation capture) and Smart RNA-seq of oocytes from 6- weeks or 10- months aged ovaries, the abnormal loose chromatin structures and disturbing expression of meiosis associated genes at metaphase I phase were disclosed. Furthermore, the transcriptomic landscape of granulosa cells (GCs) surrounding oocytes from young and aged ovaries reveled that oocyte meiotic maturation was accompanied with a robust increased expression of genes involved with the mevalonate (MVA) pathway in GCs from young ovaries but these genes expression was not upregulated to counterpart level in GCs from aged ovaries.The inhibitor of MVA pathway of GCs, Statins significantly decreased polar body extrusion rate and increased the rate of irregularly assembled spindles and misaligned chromosomes remarkably in oocytes of culumus-oocyte complex (COCs) from young ovaries . Correspondingly, the activitor of MVA pathway of GCs, Geranylgeraniol ameliorated ovarian reserve and reduced meiotic defects in oocytes of COCs from aged ovaries. Mechanistically, MVA pathway activation in GCs culminated oocyte meiotic maturation by upregulating EGF signaling via LH receptor on GCs surrounding oocytes. Together, MVA pathway is a promising therapeutic target for prompting quality of oocytes from aged ovaries.
2023-02-26 | GSE175835 | GEO
Project description:It is known that granulosa cells (GCs) mediate gonadotropin-induced oocyte meiosis resumption by releasing EGF-like factors in mammal, however, the detail molecular mechanisms remain unclear. Here, we demonstrate that luteinizing hormone (LH) surge induced histone deacetylase 3 (HDAC3) downregulation in GCs is essential for oocyte maturation. Before the LH surge, HDAC3 is highly expressed in GCs. Transcription factors, such as FOXO1, mediates recruitment of HDAC3 to the amphiregulin (Areg) promoter, which suppresses AREG expression. With the LH surge, decreased HDAC3 in GCs enables histone H3K14 acetylation and binding of the SP1 transcription factor to the Areg promoter to initiate AREG transcription and oocyte maturation. Conditional knockout of Hdac3 in granulosa cells in vivo or inhibition of HDAC3 activity in vitro promotes the maturation of oocytes independent of LH. Taking together, HDAC3 in GCs within ovarian follicles acts as a negative regulator of EGF-like growth factor expression before the LH surge.
2019-11-17 | GSE139663 | GEO
Project description:It is known that granulosa cells (GCs) mediate gonadotropin-induced oocyte meiosis resumption by releasing EGF-like factors in mammal, however, the detail molecular mechanisms remain unclear. Here, we demonstrate that luteinizing hormone (LH) surge induced histone deacetylase 3 (HDAC3) downregulation in GCs is essential for oocyte maturation. Before the LH surge, HDAC3 is highly expressed in GCs. Transcription factors, such as FOXO1, mediates recruitment of HDAC3 to the amphiregulin (Areg) promoter, which suppresses AREG expression. With the LH surge, decreased HDAC3 in GCs enables histone H3K14 acetylation and binding of the SP1 transcription factor to the Areg promoter to initiate AREG transcription and oocyte maturation. Conditional knockout of Hdac3 in granulosa cells in vivo or inhibition of HDAC3 activity in vitro promotes the maturation of oocytes independent of LH. Taking together, HDAC3 in GCs within ovarian follicles acts as a negative regulator of EGF-like growth factor expression before the LH surge.
2019-11-17 | GSE139664 | GEO
Project description:Ovulation requires sequential molecular events and structural remodeling in the ovarian follicle for the successful release of a mature oocyte capable of being fertilised. Critical to this process is progesterone receptor (PGR), a transcription factor highly yet transiently expressed in granulosa cells of preovulatory follicles. Progesterone receptor knockout (PRKO) mice are anovulatory, with a specific and complete defect in follicle rupture. Therefore, this model was used to examine the critical molecular and biochemical mechanisms necessary for successful ovulation. We used microarrays to identify putative PGR-regulated genes in granulosa cells at a time when PGR expression is maximal (eCG + 8h hCG) and the preovulatory follicle is undergoing the final changes necessary for successful ovulation.
2018-04-20 | GSE92437 | GEO
Project description:Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.
2024-10-22 | GSE206598 | GEO