Effects of oocyte-specific PIK3CA* transgene knock-in in ovaries
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA975861 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:To investigate the transcriptomic changes during the development and growth of ovarian granulosa cell tumors derived by oocyte-specific PIK3CA* transgene overexpression
2023-12-31 | GSE233313 | GEO
Project description:The goal of this study is to identify the differentially expressed genes in Gdf9-Cre mediated Mtor oocyte-specific knockout (CKO) ovaries by comparing the transcriptomes of Mtor Wild-Type (WT) and CKO Mouse ovaries via RNA-Seq Analysis.
2018-06-01 | GSE98497 | GEO
Project description:We used CRISPR/Cas9 to knock in the cancer "hotspot" mutation PIK3CA-H1047R into one or both alleles of a wild-type induced pluripotent stem cell (iPSC) line (WTC11; Coriell # GM25256; P37-P38). Three clones from each genotype (wild-type, heterozygous, homozygous) were subjected to single-end mRNA sequencing (mean read depth per sample: 20 million) to determine whether PIK3CA-H1047R exerts allele dose-dependent transcriptional effects. Multidimensional scaling demonstrated distinct transcriptomic signatures of wild-type, heterozygous and homozygous cells. The transcriptome of heterozygous cells was nearly identical to wild-type controls, with only 131 differentially-expressed transcripts (FDR = 0.05). In contrast, homozygosity for PIK3CA-H1047R led to differential expression of 1,914 genes. This indicates widespread transcriptional remodeling with a sharp allele dose-dependency, suggestive of a threshold effect.
2019-02-15 | GSE126562 | GEO
Project description:The mechanisms of oocyte meiotic defects and low competence during ovarian aging remains elusive for decades. Using Hi-C (genome-wide chromatin conformation capture) and Smart RNA-seq of oocytes from 6- weeks or 10- months aged ovaries, the abnormal loose chromatin structures and disturbing expression of meiosis associated genes at metaphase I phase were disclosed. Furthermore, the transcriptomic landscape of granulosa cells (GCs) surrounding oocytes from young and aged ovaries reveled that oocyte meiotic maturation was accompanied with a robust increased expression of genes involved with the mevalonate (MVA) pathway in GCs from young ovaries but these genes expression was not upregulated to counterpart level in GCs from aged ovaries.The inhibitor of MVA pathway of GCs, Statins significantly decreased polar body extrusion rate and increased the rate of irregularly assembled spindles and misaligned chromosomes remarkably in oocytes of culumus-oocyte complex (COCs) from young ovaries . Correspondingly, the activitor of MVA pathway of GCs, Geranylgeraniol ameliorated ovarian reserve and reduced meiotic defects in oocytes of COCs from aged ovaries. Mechanistically, MVA pathway activation in GCs culminated oocyte meiotic maturation by upregulating EGF signaling via LH receptor on GCs surrounding oocytes. Together, MVA pathway is a promising therapeutic target for prompting quality of oocytes from aged ovaries.
2023-02-26 | GSE175835 | GEO
Project description:Heterozygous and homozygous knock-in of PIK3CA-H1047R into human iPSCs
| PRJNA522373 | ENA
Project description:Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.
2024-10-22 | GSE206598 | GEO
Project description:Elavl2 knocout female mice show oocyte loss-phenotype shortly after birth. To reveal the involvement of Elavl2 in oogenic gene expression, embryonic and newborn ovaries were subjected to microarray analysis
2018-09-30 | GSE112275 | GEO
Project description:The mechanisms of oocyte meiotic defects and low competence during ovarian aging remains elusive for decades. Using Hi-C (genome-wide chromatin conformation capture) and Smart RNA-seq of oocytes from 6- weeks or 10- months aged ovaries, the abnormal loose chromatin structures and disturbing expression of meiosis associated genes at metaphase I phase were disclosed. Furthermore, the transcriptomic landscape of granulosa cells (GCs) surrounding oocytes from young and aged ovaries reveled that oocyte meiotic maturation was accompanied with a robust increased expression of genes involved with the mevalonate (MVA) pathway in GCs from young ovaries but these genes expression was not upregulated to counterpart level in GCs from aged ovaries.The inhibitor of MVA pathway of GCs, Statins significantly decreased polar body extrusion rate and increased the rate of irregularly assembled spindles and misaligned chromosomes remarkably in oocytes of culumus-oocyte complex (COCs) from young ovaries . Correspondingly, the activitor of MVA pathway of GCs, Geranylgeraniol ameliorated ovarian reserve and reduced meiotic defects in oocytes of COCs from aged ovaries. Mechanistically, MVA pathway activation in GCs culminated oocyte meiotic maturation by upregulating EGF signaling via LH receptor on GCs surrounding oocytes. Together, MVA pathway is a promising therapeutic target for prompting quality of oocytes from aged ovaries.
2023-02-26 | GSE175830 | GEO
Project description:H3K27me3 profiles using Cleavage under targets and Release using nuclease (Cut&Run) in control and KD Drosophila melanogaster ovaries. We examined the impact on chromatin profiles in Drosophila melanogaster ovaries in which the lid, the Sin3a, the Snr1 or the mod(mdg4) gene have been selectively knocked down by tissue-specific shRNA expression. We additionally explored H3K27me3 and H3K9me3 in control and dhd mutant ovaries either carrying or not a transgene.
2021-12-10 | GSE174250 | GEO
Project description:We used CRISPR/Cas9 to knock in the cancer "hotspot" mutation PIK3CA-H1047R into one or both alleles of a wild-type induced pluripotent stem cell (iPSC) line (WTC11; Coriell # GM25256; P37-P38). Four cultures from each genotype (3 wild-type clones, 3 heterozygous clones, 2 homozygous clones) were subjected to paired-end mRNA sequencing (mean read length = 150 bp). The aim of this experiment was to confirm and expand upon previous transcriptomic results suggesting a near-binary transcriptional effect in homozygous versus heterozygous PIK3CA-H1047R iPSCs (publication doi: 10.1073/pnas.1821093116). According to the high-depth transcriptomic dataset, PIK3CA-H1047R/H1047R iPSCs exhibited altered expression of 5644 genes, whereas heterozygous hPSCs showed 492 differentially-expressed genes, supporting a nearly deterministic phenotypic effect of homozygosity for PIK3CA-H1047R. The differential gene expression analyses were performed based on the limma/voom/eBayes framework (doi: 10.1093/nar/gkv007), using customised scripts with FDR < 0.05 and absolute log2(fold-change) cut-off >= 1.3.
2019-10-01 | GSE134076 | GEO