FLT3-ITD mutation expands dendritic cells and alters CD4+ T cells in acute myeloid leukemia
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE238156 | GEO | 2023/08/23
REPOSITORIES: GEO
Similar Datasets
Project description:Constitutively activating internal tandem duplication (ITD) alterations of the receptor tyrosine kinase FLT3 (Fms-like tyrosine kinase 3) are common in acute myeloid leukemia (AML) and classifies FLT3 as an attractive therapeutic target. So far, application of FLT3 small molecule inhibitors such as Sorafenib has resulted only in partial and transient clinical responses in FLT3-ITD+ patients. Only recently, a prolonged event-free survival has been observed in AML patients who were treated with Sorafenib in addition to standard therapy. Here, we studied the Sorafenib effect on proliferation in a panel of 13 FLT3-ITD- and FLT3-ITD+ AML cell lines. Sorafenib IC50 values ranged from 0.001 to 5.6 µM, whereas FLT3-ITD+ cells (MOLM-13, MV4;11) were found more sensitive to Sorafenib than FLT3-ITD- cells. However, we identified two FLT3-ITD- cell lines (MONO-MAC-1 and OCI-AML-2) which were also Sorafenib sensitive. Phosphoproteome analyses revealed that the affected pathways differed in Sorafenib sensitive FLT3-ITD- and FLT3-ITD+ cells. In MV4;11 cells Sorafenib suppressed mTOR signalling by inhibiting direct inhibition of FLT3. In MONO-MAC-1 cells Sorafenib inhibited the MEK/ERK pathway by inhibition of the RET tyrosine kinase. These data suggest that the FLT3 status in AML patients might not be the only predictive factor for a response to Sorafenib.
2017-05-02 | PXD004442 | Pride
Project description:One of the most common genetic alterations in acute myeloid leukemia is the internal tandem duplication (ITD) in the FLT3 receptor for cytokine FLT3 ligand (FLT3L). The constitutively active FLT3-ITD promotes the expansion of transformed progenitors, but also has pleiotropic effects on normal hematopoiesis. We analyzed the effect of FLT3-ITD on dendritic cells (DCs), which express FLT3 and can be expanded by FLT3L administration. We report that young pre-leukemic mice with the Flt3ITD knock-in allele manifest an expansion of all DCs including classical (cDCs) and plasmacytoid (pDCs). The expansion originated in DC progenitors, occurred in a cell-intrinsic manner and was further enhanced in Flt3ITD/ITD mice. The mutation caused the downregulation of Flt3 on the surface of DCs and reduced their responsiveness to Flt3L. Flt3ITD mice showed enhanced capacity to support T cell proliferation, including a cell-extrinsic expansion of regulatory T cells (Tregs). Accordingly, these mice restricted alloreactive T cell responses during graft-versus-host reaction, but failed to control autoimmunity in the absence of Tregs. Thus, the FLT3-ITD mutation directly affects DC development, thereby indirectly modulating T cell homeostasis and supporting Treg expansion. This effect of FLT3-ITD may subvert immunosurveillance and promote leukemogenesis in a cell-extrinsic manner.
2016-01-28 | GSE76132 | GEO
Project description:Fms-like tyrosine kinase 3 (Flt3) tyrosine kinase inhibitors (Flt3-TKI) have improved outcomes for patients with Flt3-mutated acute myeloid leukemia (AML) but are limited by resistance and relapse, suggesting persistence of leukemia stem cells (LSC). Here we utilized a Flt3-internal tandem duplication (Flt3-ITD) and Tet2-deleted AML genetic mouse model to characterize Flt3-ITD AML LSC and their resistance to Flt3-TKI. We show that LSC were enriched within the primitive ST-HSC population. CXCl12-expressing osteoprogenitors were increased in the Flt3-ITD AML marrow and FLT3-ITD LSC showed increased expression of the CXCL12 receptor CXCR4. CXCL12 deletion from the microenvironment enhanced AML targeting by combined Flt3-TKI and chemotherapy treatment with enhanced LSC targeting. We found that both treatment and CXCL12 deletion partially reduced p38 mitogen-activated protein kinase (p38) signaling with increased, but not complete, reduction seen with combined treatment and CXCL12 deletion. Our studies suggest that p38 contributes to CXCL12-mediated maintenance of AML LSC following Flt3-TKI and chemotherapy treatment, but that p38 inhibition enhances AML LSC response to treatment to a greater extent than CXCL12 deletion alone. This study supports a role for p38 signaling in CXCL12-mediated protection of AML LSC from treatment and provide a rationale for targeting p38 signaling to enhance Flt3-ITD AML targeting.
2024-01-03 | GSE212428 | GEO
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
2014-01-15 | GSE54065 | GEO
Project description:Internal tandem duplication (ITD) mutations within the FMS-like receptor tyrosine kinase-3 (FLT3) can be found in up to 25~30% of acute myeloid leukemia (AML) patients and confer a poor prognosis. Although FLT3 tyrosine kinase inhibitors (TKIs) have shown clinical responses, the overall outcome of FLT3-ITD+ AML patients remains poor, and most of them would relapse very shortly. TKIs can not eliminate primitive FLT3-ITD+ AML cells, which are potential sources of relapse. Therefore, elucidating the mechanisms underlying FLT3-ITD+ AML maintenance and drug resistance is essential to develop novel, effective treatment strategies. Here, we demonstrate that FLT3 inhibition induces histone deacetylase 8 (HDAC8) upregulation through FOXO1 and FOXO3-mediated transactivation in FLT3-ITD+ AML cells. Upregulated HDAC8 deacetylates and inactivates p53, leading to leukemia maintenance and drug resistance upon TKIs treatment. Genetic or pharmacological inhibition of HDAC8 re-activates p53, abrogates leukemia maintenance and significantly enhances TKI-mediated elimination of FLT3-ITD+ AML cells. Importantly, in FLT3-ITD+ AML patient-derived xenograft models, the combination of FLT3 TKI (AC220) with a HDAC8 inhibitor (22d) significantly inhibits leukemia progression and effectively reduces primitive FLT3-ITD+ AML cells. Moreover, we extend these findings to an AML subtype harboring another tyrosine kinase activating mutation. In conclusion, our study demonstrates that HDAC8 upregulation as an important mechanism to resist TKIs and promote leukemia maintenance, and suggests that combining HDAC8 inhibition with TKI treatment could be a promising strategy to treat FLT3-ITD+ AML and other tyrosine kinase mutation-harboring leukemias.
2020-02-13 | GSE138057 | GEO
Project description:Kinase hyperactivity is a common driver of acute myeloid leukemia (AML) and serves as a therapeutic target. The most frequent genetic aberration leading to hyperactive kinase signaling and poor prognosis is internal tandem duplication (ITD) of the FMS-tyrosine-like Kinase 3-gene (FLT3). FLT3-ITD induces ligand independent activation of FLT3 and downstream pathways leading to proliferation, decreased apoptosis and partial differentiation block. Combined with chemotherapy, FLT3-Tyrosine Kinase Inhibitor (FLT3-TKI) midostaurin improves overall survival (OS) of newly diagnosed FLT3-mutated AML patients, whereas single agent gilteritinib proved superior to chemotherapy in relapsed/refractory FLT3-mutated AML patients . As the primary targets of currently approved FLT3-TKIs are tyrosine (Y) kinases, we hypothesized that direct evaluation of tyrosine phosphorylation status could reveal pY phosphorylation profiles associated with FLT3-TKI response. Therefore, we used label-free pTyr-based phosphoproteomics in 35 primary AML samples (18 FLT3-WT, 17 FLT3-ITD), to identify differentially phosphorylated proteins underlying response to the FLT3-TKIs gilteritinib and midostaurin. We identified a total of 3024 unique phosphosites (median 1299 per sample, range 286 – 1612, pS:pT:pY 11.9%:9.5%:78.6%). Due to low number of identified phosphosites, we excluded two samples from further analyses. On the remaining 33 samples, we additionally performed IMAC global phosphoproteomics and on 17 samples protein expression analysis.
2021-09-10 | PXD024235 | Pride
Project description:FMS-like tyrosine kinase 3 (FLT3) is the most frequently mutated gene in acute myeloid leukemia (AML), and is associated with a poor prognosis and high relapse rate. Gilteritinib, as a second-generation FLT3 inhibitor, is an important target drug in the treatment of FLT3-ITD AML patients, but it still faces the problems of drug resistance and reduced potency. In this study, we found that mitoxantrone-liposome can sensensitized gilteritinib and enhanced the therapeutic effect in vivo and in vitro. RNA-sequencing revealed that the combination treatment resulted in specific changes in gene expression, reduced drug resistance and the mechanism. Primary AML cells harvested from patients with FLT3-ITD AML showed a significant response to combination treatment in vitro. Our data suggest represents a novel and promising therapeutic strategy for FLT3-ITD AML patients and relapsed/refractory(R/R) AML.
2025-03-19 | GSE276384 | GEO
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Acute myeloid leukemia with normal karyotype (NK-AML) represents a cytogenetic grouping with intermediate prognosis but substantial molecular and clinical heterogeneity. Within this subgroup, presence of FLT3 (FMS-like tyrosine kinase 3) internal tandem duplication (ITD) mutation predicts less favorable outcome. The goal of our study was to discover gene-expression patterns correlated with FLT3-ITD mutation, and to evaluate the utility of a FLT3 signature for prognostication. The dataset comprises gene-expression profiles of 137 normal karyotype acute myeloid leukemia (NK-AML) specimens carried out using Stanford cDNA microarrays, to accompany the study of L Bullinger et al. For each array, Channel 2 represents Cy5-labeled NK-AML RNA, and Channel 1 Cy3-labeled universal reference RNA. Keywords: Logical Set DNA microarrays were used to profile gene expression in a training set of 65 NK-AML cases. Supervised analysis was applied to build a gene expression-based predictor of FLT3-ITD mutation status. The predictor was then evaluated by classifying expression profiles from an independent test set of 72 NK-AML cases.
2008-02-27 | E-GEOD-8043 | biostudies-arrayexpress
Project description:FLT3 activating mutations cause myeloproliferative neoplasms by deregulating hematopoietic progenitor cell growth, and acute myeloid leukemia is on the rise. Investigational drugs targeting mutant FLT3, including Quizartinib and Crenolanib, develop inherent and acquired resistance to FLT3 targeted therapy. FLT3 inhibitor resistance in AML is dependent on co-occurring mutations, parallel survival pathways, and/or subsequent FLT3-ITD mutations. Despite the high prevalence of FLT3 mutations and their clinical significance in AML, there are few targeted therapeutic options. We identified two novel naphthyridine-based FLT3 inhibitors (HSN608 and HSN748) that specifically target FLT3-ITD at sub-nanomolar concentrations and are effective against drug-resistant secondary mutations. In the current study, we evaluated these compounds antileukemic activity against FLT3-ITD and gatekeeper mutations in drug-resistant AML, relapsed/refractory AMLs with FLT3 mutations, and in vivo mouse models with combinations of epigenetic mutations TET2 with FLT3-ITD, and AML patients PDX. In these model systems, we demonstrate that HSN748 outperforms the FDA-approved FLT3 inhibitor Gilteritinib in terms of inhibitory activity against FLT3-ITD.
2022-12-07 | MSV000090855 | MassIVE