Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

CRISPRi screen identifies core regions in IGH enhancers essential for non-Hodgkin lymphoma cells survival

ABSTRACT: Chromosomal translocations in non-Hodgkin lymphoma (NHL) are known to bring oncogenes (e.g. MYC, BCL2) under the regulation of immunoglobulin heavy chain (IGH) super-enhancers, composed of the intronic Eµ enhancer and 3’ regulatory regions (3’RR1, 3’RR2). Deregulation of translocated oncogenes by enhancer activity can contribute to lymphomagenesis. The role of IGH enhancers in normal B-cell development is well established, but the knowledge regarding precise mechanisms of their involvement in control of the translocated oncogenes is limited. We previously identified exact regions within IGH regulatory elements, one in the Eµ and two in each of the 3'RRs, whose targeting profoundly inhibited NHL cells growth. The goal of this project was to reveal enhancer RNAs (eRNA) transcribed from Eµ and 3'RRs and their essential regions. With the use of chromatin-enriched RNA-Seq we confirmed bi-directional transcription from those core enhancer regions and further validated eRNAs expression in a large panel of NHL cell lines and in patient-derived samples. We showed in several NHL cell lines that CRISPR/dCas9-KRAB-mediated inhibition of essential IGH enhancer regions decreased expression of eRNAs and translocated oncogenes in the fashion likely related to their breakpoints pattern within IGH locus. Our results provide new insights into the current understanding of IGH enhancers role in B-cell NHLs.

ORGANISM(S): Homo sapiens

PROVIDER: GSE247393 | GEO | 2024/06/10

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Effects of the HDACi SAHA on IgH transcription in B-cell splenocytes and effect of deletion of two cis-transcriptional enhancer on IgH transcription in femoral B-cells.

Project description:B-cell development is spatially and temporally regulated with the Ig heavy chain (IgH) locus as a conductor. Starting with the first steps of B-cell development, IgH DNA remodeling constantly occurs under the control of several cis-regulatory elements scattered all along the IgH locus. Their individual genomic deletion had partial or no effect on B-cell development. In this study we investigate the effect of the dual deletion of 5’Eµ and 3’RR enhancer on IgH transcription. Numerous B-cell lymphomas feature translocations linking oncogenes with the IgH locus and epigenetic drugs such as histone deacetylase inhibitors (HDACi) have been approved to treat some of them. In this study we investigated IgH locus transcription in B-cell splenocytes stimùulated with LPS and the HDACi SAHA.

2021-03-27 | GSE169691 | GEO

A mouse model of endemic Burkitt translocations reveals the long-range boundaries of Ig-mediated oncogene deregulation

Project description:Igh/Myc translocations underlie both sporadic Burkitt lymphoma (BL) and the endemic clinical form affecting African children infected with malaria. However, while sporadic translocations decapitate Myc from 5' proximal regulatory elements, most endemic events occur hundreds of kilobases away from Myc. The origin of these rearrangements and how they deregulate oncogenes at such distances remain unclear. Here we recapitulate endemic BL-like translocations in plasmacytomas from uracil N-glycosylase (UNG) deficient mice. We demonstrate that in these animals, rare endemic-like translocations arise from non-targeted DNA breaks at Myc loci. Deep-sequencing analyses revealed that the deregulated 3' Igh enhancer alpha physically interacts with and remodels 0.45Mb of translocated chromatin. The results thus explain the long-range deregulation of oncogenes in human and mouse B cell tumors. ChIP-Seq, 4C, and 1 RNASeq samples used to characterize mouse plasmacytoma cell lines and in vitro activated mouse B cells. Biological replicates are present for many of the samples.

2013-07-04 | E-GEOD-48514 | biostudies-arrayexpress

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Functional Importance of eRNAs for Estrogen-dependent Gene Transcriptional Activation

Project description:The functional importance of gene enhancers in regulated gene expression is well established. In addition to widespread transcription of long non-coding RNA (ncRNA) transcripts in mammalian cells, bidirectional ncRNAs referred to as eRNAs are present on enhancers. However, it has remained unclear whether these eRNAs are functional, or merely a reflection of enhancer activation. Here, we report that 17 ?-estradiol (E2)-bound estrogen receptor alpha (ER?) on enhancers causes a global increase in eRNA transcription on enhancers adjacent to E2 upregulated coding genes. These induced eRNAs, as functional transcripts, appear to exert important roles for the observed ligand-dependent induction of target coding genes, causing an increased strength of specific enhancer:promoter looping initiated by ER? binding. Cohesin, present on many ER?-regulated enhancers even prior to ligand treatment, apparently contributes to E2-dependent gene activation by stabilizing E2/ER?/eRNA-induced enhancer:promoter looping. Our data indicate that eRNAs are likely to exert important functions in many regulated programs of gene transcription. The ChIP-seqs in this study measure the binding landscape of master transcription regulator of estrogen signaling - ER?, together with common histone marks including H3K27ac and H3K4me1 in MCF7 cells. These data serve as the basis to understand the enhancer map and subsequent analysis of eRNA expression using GRO-seq. The GRO-seq measures the trancription of nascent RNAs in the genome. From MCF7 cells treated with veichle or estrodial, we could identify estrogen-regulated eRNAs and subsequently could study their functions.

2013-06-04 | E-GEOD-45822 | biostudies-arrayexpress

The superenhancer binding factor Med1 is broadly required for optimally expressing and hypermutating IgH genes as well as for terminating their expression through locus suicide recombination

Project description:Assembly, expression and maturation of the Immunoglobulin heavy (IgH) chain repertoire necessitates long-range 3D-interactions under regulation by the IgH locus Eµ and 3’ regulatory region (3’RR) super-enhancers. In progenitors, Eµ instrumentally supports VDJ recombination notably towards distal VH genes. In mature cells, the 3’RR first boosts the production of membrane-type IgH transcripts. It later attracts Activation-induced cytidine deaminase at three specific locations: VDJ genes undergoing somatic hypermutation (SHM), switch regions undergoing class switch recombination (CSR), and the 3’RR itself during locus suicide recombination (LSR). In plasma cells devoted to abundant Ig secretion, a late long-range effect is to promote high IgH transcription. The Mediator subunit Med1, which binds super-enhancers and has increased activity after phosphorylation by ERK, was previously attributed a role restricted to class-switched cells. We now show its broader impact on IgH expression, both by promoting recombination of distal VH genes in progenitors and by later supporting SHM. Med1-dependence also marks all long-range functions of the 3’RR, including not only intra- but also trans-chromosomal CSR, LSR, optimal BCR expression and the transcriptional boost featured by plasma cells. Altogether, Med1 appears as a major and specific actor of all the long-range tasks effected by the IgH locus super-enhancers beyond transcription.

2022-10-20 | GSE136845 | GEO

Epigenomic translocation of H3K4me3 broad domains following super-enhancer hijacking

Project description:Chromosomal translocations are important drivers of haematological malignancies whereby proto-oncogenes are activated by juxtaposition with super-enhancers, often called super-enhancer hijacking. We analysed the epigenomic consequences of rearrangements between the enhancers of the immunoglobulin heavy chain locus (IGH) and proto-oncogene CCND1 that are common in B-cell malignancies. By integrating BLUEPRINT epigenomic data with DNA breakpoint detection, we characterised the normal chromatin landscape of the human IGH locus and its dynamics after pathological genomic rearrangement. We detected an H3K4me3 broad domain (BD) within the IGH locus of healthy B-cells that was absent in samples with IGH-CCND1 translocations. The appearance of H3K4me3-BD over CCND1 in the latter was associated with overexpression and extensive chromatin accessibility of this locus. We observed similar cancer-specific H3K4me3-BDs associated with super-enhancer hijacking of other common oncogenes in B-cell (MAF, MYC and FGFR3) and in T-cell malignancies (LMO2, TLX3 and TAL1). Our analysis suggests that H3K4me3-BDs are created by super-enhancers and supports the new concept of epigenomic translocation, where the relocation of H3K4me3-BDs accompanies the translocation of super-enhancers.

2020-08-12 | GSE151556 | GEO

A mouse model of endemic Burkitt translocations reveals the long-range boundaries of Ig-mediated oncogene deregulation

2013-07-04 | GSE48514 | GEO

The histone variant H2A.Z is an important regulator of enhancer activity.

Project description:Gene regulatory programs in different cell types are largely defined through cell-specific enhancers activity. The histone variant H2A.Z has been shown to play important roles in transcription mainly by controlling proximal promoters, but its effect on enhancer functions remains unclear. Here, we demonstrate by genome-wide approaches that H2A.Z is present at a subset of active enhancers bound by the estrogen receptor alpha (ERα). We also determine that H2A.Z does not influence the local nucleosome positioning around ERα-enhancers using ChIP-sequencing at nucleosomal resolution and unsupervised pattern discovery. We further highlight that H2A.Z-enriched enhancers are associated with chromatin accessibility, H3K122ac enrichment and hypomethylated DNA. Moreover, upon estrogen stimulation, the enhancers occupied by H2A.Z produce enhancer RNAs (eRNAs), and recruit RNA polymerase II as well as RAD21, a member of the cohesin complex involved in chromatin interactions between enhancers and promoters. Importantly, their recruitment and eRNAs production are abolished by H2A.Z depletion, thereby revealing a novel functional link between H2A.Z occupancy and enhancer activity. Taken together, our findings suggest that H2A.Z acts as an important player for enhancer functions by establishing and maintaining a chromatin environment required for RNA polymerase II recruitment, eRNAs transcription and enhancer-promoters interactions, all essential attributes of enhancer activity. The MNase ChIP-seqs in this study measure the genome-wide binding landscape of H2A.Z, H3K4me1, H3K27ac and H3K4me3 in MCF-7 cells in the absence or presence of E2. Two biological replicates were done for each ChIP-seq experiment and for each condition, as well as, control input.

2015-08-31 | E-GEOD-57436 | biostudies-arrayexpress

Rev-Erbs repress macrophage gene expression by inhibiting enhancer-directed transcription

Project description:Rev-Erba and Rev-Erbb are nuclear receptors that regulate the expression of genes involved in the control of circadian rhythm, metabolism, and inflammatory responses. Rev-Erbs function as transcriptional repressors by recruiting NCoR/HDAC3 co-repressor complexes to Rev-Erb response elements in enhancers and promoters of target genes, but the molecular basis for cell-specific programs of repression is not known. Here, we present evidence that in macrophages, Rev-Erbs regulate target gene expression by inhibiting the functions of distal enhancers that are selected by macrophage lineage-determining factors, thereby establishing a macrophage-specific program of repression. Remarkably, the repressive functions of Rev-Erbs are associated with their ability to inhibit the transcription of enhancer-derived RNAs (eRNAs). Furthermore, targeted degradation of eRNAs at two enhancers subject to negative regulation by Rev-Erbs resulted in reduced expression of nearby mRNAs, implying a direct role of these eRNAs in enhancer function. By precisely defining eRNA start sites using a method that quantifies nascent 5' ends (5'-GRO-Seq), we show that transfer of full enhancer activity to a target promoter requires both the sequences mediating transcription factor binding and the specific sequences encoding the eRNA transcript. These studies provide evidence for direct roles of eRNAs in contributing to enhancer functions and suggest that Rev-Erbs act to suppress gene expression at a distance by repressing eRNA transcription. Using ChIPseq, GRO-seq, and 5'GRO-seq to determine mechanism of RevErb in transcriptional regulation in macrophages

2013-06-05 | E-GEOD-45914 | biostudies-arrayexpress

Enhancer RNAs stimulate Pol II pause release by harnessing multivalent interactions to NELF

Project description:UV-light-induced protein-RNA cross-linking followed by MS analysis was used to identify RNA-binding regions of enhancer RNAs (eRNAs) to the negative elongation factor (NELF) complex, and NELF as part of the paused elongation complex (PEC) of human RNA polymerase II.

2022-03-08 | PXD030569 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data