Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Unveiling the signaling network of FLT3-ITD AML improves drug sensitivity prediction

ABSTRACT: Currently, the identification of patient-specific therapies in cancer is mainly informed by personalized genomic analysis. In the setting of acute myeloid leukemia (AML), patient-drug treatment matching fails in a subset of patients harboring atypical internal tandem duplications (ITDs) in the tyrosine kinase domain of the FLT3 gene. To address this unmet medical need, here we develop a systems-based strategy that integrates multiparametric analysis of crucial signaling pathways, patient-specific genomic and transcriptomic data with a prior-knowledge signaling network using a Boolean-based formalism. By this approach, we derive personalized predictive models describing the signaling landscape of AML FLT3-ITD positive cell lines and patients. These models enable us to derive mechanistic insight into drug resistance mechanisms and suggest novel opportunities for combinatorial treatments. Interestingly, our analysis reveals that the JNK kinase pathway plays a crucial role in the tyrosine kinase inhibitor response of FLT3-ITD cells through cell cycle regulation. Finally, our work shows that patient-specific logic models have the potential to inform precision medicine approaches.

ORGANISM(S): Homo sapiens

PROVIDER: GSE247483 | GEO | 2024/03/22

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

A network-based approach reveals a novel mechanism of resistance to TKI-therapy in AML

Project description:Internal tandem duplications (ITDs) in the FLT3 gene are frequently identified and confer a poor prognosis in patient affected by acute myeloid leukemia (AML). The insertion site of the ITDs in FLT3 significantly impacts the sensitivity to tyrosine kinase inhibitors (TKIs) therapy, affecting patient’s clinical outcome. To decipher the molecular mechanisms driving the different sensitivity to TKIs therapy of FLT3-ITD cells, we used high-sensitive mass spectrometry-based (phospho)proteomics and deep sequencing. Here, we developed a novel generally-applicable data analysis strategy, dubbed “Signaling Profiler”, that supports the integration of unbiased large-scale datasets with literature-derived signaling networks. The approach resulted in the generation of FLT3-ITDs specific predictive models and reveales a crucial and conserved role of the WEE1-CDK1 axis in TKIs resistance. Remarkably, pharmacological inhibition of the WEE1 kinase significantly synergizes and strengths the pro-apoptotic effect of TKIs therapy in cell lines and patient-derived primary blasts. In conclusion, this work proposes a new molecular mechanism of TKIs resistance in AML and suggests a combination therapy as option to improve therapeutic efficacy.

2023-03-10 | PXD033953 | Pride

FLT3 inhibition upregulates HDAC8 via FOXO to inactivate p53 and promote maintenance of FLT3-ITD+ acute myeloid leukemia

Project description:Internal tandem duplication (ITD) mutations within the FMS-like receptor tyrosine kinase-3 (FLT3) can be found in up to 25~30% of acute myeloid leukemia (AML) patients and confer a poor prognosis. Although FLT3 tyrosine kinase inhibitors (TKIs) have shown clinical responses, the overall outcome of FLT3-ITD+ AML patients remains poor, and most of them would relapse very shortly. TKIs can not eliminate primitive FLT3-ITD+ AML cells, which are potential sources of relapse. Therefore, elucidating the mechanisms underlying FLT3-ITD+ AML maintenance and drug resistance is essential to develop novel, effective treatment strategies. Here, we demonstrate that FLT3 inhibition induces histone deacetylase 8 (HDAC8) upregulation through FOXO1 and FOXO3-mediated transactivation in FLT3-ITD+ AML cells. Upregulated HDAC8 deacetylates and inactivates p53, leading to leukemia maintenance and drug resistance upon TKIs treatment. Genetic or pharmacological inhibition of HDAC8 re-activates p53, abrogates leukemia maintenance and significantly enhances TKI-mediated elimination of FLT3-ITD+ AML cells. Importantly, in FLT3-ITD+ AML patient-derived xenograft models, the combination of FLT3 TKI (AC220) with a HDAC8 inhibitor (22d) significantly inhibits leukemia progression and effectively reduces primitive FLT3-ITD+ AML cells. Moreover, we extend these findings to an AML subtype harboring another tyrosine kinase activating mutation. In conclusion, our study demonstrates that HDAC8 upregulation as an important mechanism to resist TKIs and promote leukemia maintenance, and suggests that combining HDAC8 inhibition with TKI treatment could be a promising strategy to treat FLT3-ITD+ AML and other tyrosine kinase mutation-harboring leukemias.

2020-02-13 | GSE138057 | GEO

PRMT1-mediated FLT3 arginine methylation is required for maintenance of FLT3-ITD+ Acute Myeloid Leukemia

Project description:The presence of FLT3-ITD mutations in patients with acute myeloid leukemia (AML) is associated with poor clinical outcome. FLT3 tyrosine kinase inhibitors (TKIs), although effective in kinase ablation, do not eliminate FLT3-ITD+ leukemia stem cells (LSCs) which are potential sources of disease relapse, prompting us to ask whether FLT3-ITD protein regulates the AML LSCs survival through a kinase-independent mechanism. Here, we show that expression of PRMT1, the primary type I arginine methyltransferase, significantly increases in LSC-enriched CD34+CD38- populations relative to normal counterparts. Genetic PRMT1 depletion blocked AML CD34+ cell survival, and had more potent effects in AML cells from patients harboring FLT3-ITD. Our genome wide analysis of gene expression and PRMT1 conditional KO mouse study confirmed that PRMT1 preferentially cooperates with FLT3-ITD contributing to AML cell maintenance. Mechanistically, PRMT1 catalyzed FLT3-ITD protein methylation at arginines 972/973, and PRMT1 promoted leukemia cell growth in a FLT3 methylation-dependent manner. Moreover, effects of FLT3-ITD methylation in AML cells were in part due to crosstalk with FLT3-ITD phosphorylation at tyrosine 969 (Y969). Importantly, FLT3 methylation persisted in FLT3-ITD+ AML cells following TKI (AC220) treatment, indicating that methylation occurs independently of kinase activity. Finally, in both patient-derived xenograft (PDX) and murine AML models, combined administration of AC220 with a type I PRMT inhibitor (MS023) enhanced elimination of FLT3-ITD+ AML relative to AC220 treatment alone. Our study demonstrates that PRMT1-mediated FLT3 methylation promotes LSC activity and suggests that combining PRMT1 inhibition with FLT3 TKI treatment could be a promising approach to selectively target FLT3-ITD+ LSCs.

2021-11-10 | GSE122435 | GEO

GRP94 rewires and buffers the FLT3-ITD signaling network and promotes survival of acute myeloid leukemic stem cells

Project description:Internal tandem duplications in the tyrosine kinase receptor FLT3 (FLT3-ITD) are among the most common lesions in acute myeloid leukemia (AML) and there exists a need for new forms of treatment. Using ex vivo drug sensitivity screening, we found that FLT3-ITD+ patient cells are particularly sensitive to HSP90 inhibitors. While it is well known that HSP90 is important for FLT3-ITD stability, we found that HSP90 family members play a much more complex role in FLT3-ITD signaling than previously appreciated. First, we found that FLT3-ITD activates the unfolded protein response (UPR), leading to increased expression of GRP94/HSP90B1. GRP94 rewires FLT3-ITD signaling by binding and retaining FLT3-ITD in the ER, where it aberrantly activates downstream signaling pathways. Second, HSP90 family proteins protect FLT3-ITD+ AML cells against apoptosis by alleviating proteotoxic stress, and treatment with HSP90 inhibitors results in proteotoxic overload that triggers UPR-induced apoptosis. Importantly, leukemic stem cells are strongly dependent upon HSP90 for their survival, and the HSP90 inhibitor ganetespib causes leukemic stem cell exhaustion in mouse PDX models. Taken together, our study reveals a molecular basis for HSP90 addiction of FLT3-ITD+ AML cells and provides a rationale for including HSP90 inhibitors in the treatment regime for FLT3-ITD+ AML.

2020-09-02 | PXD009423 | Pride

Phosphoproteome Analysis Reveals Differential Mode of Action of Sorafenib in Wildtype and Mutated FLT3 AML Cells

Project description:Constitutively activating internal tandem duplication (ITD) alterations of the receptor tyrosine kinase FLT3 (Fms-like tyrosine kinase 3) are common in acute myeloid leukemia (AML) and classifies FLT3 as an attractive therapeutic target. So far, application of FLT3 small molecule inhibitors such as Sorafenib has resulted only in partial and transient clinical responses in FLT3-ITD+ patients. Only recently, a prolonged event-free survival has been observed in AML patients who were treated with Sorafenib in addition to standard therapy. Here, we studied the Sorafenib effect on proliferation in a panel of 13 FLT3-ITD- and FLT3-ITD+ AML cell lines. Sorafenib IC50 values ranged from 0.001 to 5.6 µM, whereas FLT3-ITD+ cells (MOLM-13, MV4;11) were found more sensitive to Sorafenib than FLT3-ITD- cells. However, we identified two FLT3-ITD- cell lines (MONO-MAC-1 and OCI-AML-2) which were also Sorafenib sensitive. Phosphoproteome analyses revealed that the affected pathways differed in Sorafenib sensitive FLT3-ITD- and FLT3-ITD+ cells. In MV4;11 cells Sorafenib suppressed mTOR signalling by inhibiting direct inhibition of FLT3. In MONO-MAC-1 cells Sorafenib inhibited the MEK/ERK pathway by inhibition of the RET tyrosine kinase. These data suggest that the FLT3 status in AML patients might not be the only predictive factor for a response to Sorafenib.

2017-05-02 | PXD004442 | Pride

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

2014-01-15 | GSE54065 | GEO

Distinct biological and transcriptional features of FLT3-ITD variants in vitro and in vivo

Project description:Treatment of FLT3-ITD mutated AML remains a clinical challenge as this subset of patients show high incidence of relapse, even after allogeneic stem cell transplantation. Recently, we defined a molecular subset of FLT3-ITD mutations, located in the FLT3-tyrosine kinase domain 1 (TKD1). In multivariable analyses, insertion of ITD variants in the beta1-sheet (TKD1) was identified as an unfavorable prognostic factor for achievement of a complete remission relapse-free survival and overall survival independently of other prognostic factors such as allelic ratio. In the presented analysis we characterize ITD variants located in the TKD1. While transforming capacity and activation of downstream signaling nodes appears comparable to ‘classical’ ITD mutations located in the JM-domain, TKD1-ITDs reveal a distinct gene expression profile and confer decreased sensitivity to kinase inhibitor therapy in vitro and in vivo. This knowledge may impact clinical decisions in regard to TKI therapy versus allogeneic stem cell transplantation.

2014-12-31 | GSE56241 | GEO

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Global phosphoproteome analysis of human bone marrow reveals predictive phosphorylation markers for the treatment of acute myeloid leukemia with quizartinib

Project description:Treatment with inhibitors of the receptor tyrosine kinase FLT3 are currently studied as promising therapies in acute myeloid leukemia (AML). However, only a subset of patients benefit from these treatments and the presence of activating mutations within FLT3 can predict response to a certain extent only. AC220 (quizartinib) is an example of a potent FLT3 inhibitor1 that was studied in a recent phase II open-label study in patients with relapsed/refractory AML. The complete remission rate (including CRp and CRi) in FLT3-ITD-positive patients was 54% (50/92) and the corresponding partial remission rate (PR) was 17% (16/92)2 Thus, although the FLT3-ITD mutation status correlates with response, the error rate in stratification of patients into responders and non-responders is high, as still 29% of the FLT3-ITD-positive patients failed to respond. Exclusion of FLT3-ITD-negative patients from AC220 treatment also seems critical, as the total response rate (CRþPR) in FLT3-ITD-negative patients is substantially lower (41%, 17/41). As AC220 is a tyrosine kinase inhibitor, we hypothesized that investigating phosphorylation-based signaling on a system-wide scale in AML cells allows for identification of markers enabling more accurate prediction of therapy response as compared to commonly used genetic markers. Hence, we applied quantitative mass spectrometry to decipher a multivariate phosphorylation site marker, which we refer to as phosphosignature, in patient-derived AML blasts that might be useful as predictive biomarkers for AC220 treatment.

2017-05-10 | PXD006475 | Pride

Microenvironmental CXCL12 Deletion Enhances Flt3-ITD Acute Myeloid Leukemia Stem Cell Response to Therapy by Reducing p38 MAPK Signaling

Project description:Fms-like tyrosine kinase 3 (Flt3) tyrosine kinase inhibitors (Flt3-TKI) have improved outcomes for patients with Flt3-mutated acute myeloid leukemia (AML) but are limited by resistance and relapse, suggesting persistence of leukemia stem cells (LSC). Here we utilized a Flt3-internal tandem duplication (Flt3-ITD) and Tet2-deleted AML genetic mouse model to characterize Flt3-ITD AML LSC and their resistance to Flt3-TKI. We show that LSC were enriched within the primitive ST-HSC population. CXCl12-expressing osteoprogenitors were increased in the Flt3-ITD AML marrow and FLT3-ITD LSC showed increased expression of the CXCL12 receptor CXCR4. CXCL12 deletion from the microenvironment enhanced AML targeting by combined Flt3-TKI and chemotherapy treatment with enhanced LSC targeting. We found that both treatment and CXCL12 deletion partially reduced p38 mitogen-activated protein kinase (p38) signaling with increased, but not complete, reduction seen with combined treatment and CXCL12 deletion. Our studies suggest that p38 contributes to CXCL12-mediated maintenance of AML LSC following Flt3-TKI and chemotherapy treatment, but that p38 inhibition enhances AML LSC response to treatment to a greater extent than CXCL12 deletion alone. This study supports a role for p38 signaling in CXCL12-mediated protection of AML LSC from treatment and provide a rationale for targeting p38 signaling to enhance Flt3-ITD AML targeting.

2024-01-03 | GSE212428 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data