Dataset Information

Chemically induced expansion of type 2 alveolar epithelial cell promotes regenerative lower airway repair [RNA-seq]

ABSTRACT: Type 2 alveolar epithelial cells (AEC2s) are stem cells in the adult lung that contribute to lower airway repair. Agents that promote the selective expansion of these cells might stimulate regeneration of the compromised alveolar epithelium, an etiology defining event in several pulmonary diseases. From a high content imaging screen of the drug repurposing library ReFRAME, we identified that dipeptidyl peptidase 4 (DPP4) inhibitors, widely used type 2 diabetes medications, selectively expand AEC2s and are broadly efficacious in several mouse models of lung damage. Mechanism of action studies revealed that the protease DPP4, in addition to processing incretin hormones, degrades IGF-1 and IL-6, essential regulators of AEC2 expansion whose levels are increased in the luminal compartment of the lung in response to drug treatment. To selectively target DPP4 in the lung with sufficient drug exposure, we developed NZ-97, a locally delivered, lung persistent DPP4 inhibitor that broadly promotes efficacy in mouse lung damage models with minimal peripheral exposure and good tolerability. This work reveals DPP4 as a central regulator of AEC2 expansion and affords a promising therapeutic approach to broadly stimulate regenerative repair in pulmonary disease.

ORGANISM(S): Homo sapiens

PROVIDER: GSE262398 | GEO | 2024/03/27

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

Dataset Information

Chemically induced expansion of type 2 alveolar epithelial cell promotes regenerative lower airway repair [RNA-seq]

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets