Dataset Information

Hyaluronan and TLR4 Regulate Alveolar Stem Cell Renewal and Prevent Severe Pulmonary Fibrosis

ABSTRACT: The successful repair of alveolar epithelial injury is required to restore the integrity of gas exchanging regions of the lung and preserve organ function. Severe pulmonary fibrosis is the result of repeated episodes of epithelial injury, activation of fibroblasts, and matrix accumulation. Thus, impaired alveolar epithelial progenitor cell renewal could contribute to the progression of fibrosis. We provide evidence that expression of TLR4 and hyaluronan (HA) on Type 2 alveolar epithelial cells (AEC2s) is necessary for self-renewal. Either deletion of TLR4 or HA synthase 2 leads to impaired regeneration of AEC2s, severe fibrosis and mortality, in part due to blunted production of IL-6. AEC2s from patients with pulmonary fibrosis have reduced cell surface HA, and impaired renewal capacity, suggesting that interactions between HA and TLR4 are key regulators of lung stem cell renewal, repair of lung injury and that severe pulmonary fibrosis is the result of epithelial stem cell failure. We used microarrays to detail the gene expression of AEC2 cells from WT and TLR4-/- mice.

ORGANISM(S): Mus musculus

PROVIDER: GSE68704 | GEO | 2016/10/03

SECONDARY ACCESSION(S): PRJNA283423

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

Dataset Information

Hyaluronan and TLR4 Regulate Alveolar Stem Cell Renewal and Prevent Severe Pulmonary Fibrosis

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets