Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

TLDR (True Length of Diverse capped RNAs)-seq: a method for 5’-to-3’ end sequencing of capped full-length RNAs with or without 3’ polyadenylation

ABSTRACT: Analysis and understanding of transcript functions is greatly helped by knowing the full-length sequence of individual RNAs. New long-read sequencing devices such as Oxford Nanopore and Pacbio have the potential to sequence full-length transcripts, but standard methods lack the ability to capture true RNA 5’ ends and selects for poly-adenylated (pA+) transcripts. We present a method that, by utilizing cap-trapping and 3’ end adapter ligation, can sequence transcripts from the exact 5’ end to 3’ end regardless of whether they are poly-adenylated, with no need for ribosomal RNA depletion. We show that the method can faithfully detect 5’ ends, splice junctions and 3’ ends, has high reproducibility between runs and gene expression estimates from the method correlate well with short-read sequencing methods. We also demonstrate that the method can detect and sequence full-length pA- RNAs, including lncRNAs, promoter upstream transcripts (PROMPTs) and enhancer RNAs. TLDR-seq is therefore useful for the characterization of diverse capped RNA species.

ORGANISM(S): Mus musculus Homo sapiens

PROVIDER: GSE279131 | GEO | 2025/04/09

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

TLDR (True Length of Diverse capped RNAs)-seq: a method for 5’-to-3’ end sequencing of capped full-length RNAs with or without 3’ polyadenylation [R10]

Project description:Analysis and understanding of transcript functions is greatly helped by knowing the full-length sequence of individual RNAs. New long-read sequencing devices such as Oxford Nanopore and Pacbio have the potential to sequence full-length transcripts, but standard methods lack the ability to capture true RNA 5’ ends and selects for poly-adenylated (pA+) transcripts. We present a method that, by utilizing cap-trapping and 3’ end adapter ligation, can sequence transcripts from the exact 5’ end to 3’ end regardless of whether they are poly-adenylated, with no need for ribosomal RNA depletion. We show that the method can faithfully detect 5’ ends, splice junctions and 3’ ends, has high reproducibility between runs and gene expression estimates from the method correlate well with short-read sequencing methods. We also demonstrate that the method can detect and sequence full-length pA- RNAs, including lncRNAs, promoter upstream transcripts (PROMPTs) and enhancer RNAs. TLDR-seq is therefore useful for the characterization of diverse capped RNA species.

2025-04-09 | GSE289428 | GEO

5CAPture-seq: a method for enriching full-length cDNA and identifying 5′ capped nucleotides

Project description:Current transcriptomic methods for mapping 5′-ends of eukaryotic RNA employ only 5′-end enriched samples. The absence of a matched unenriched control limits the ability to distinguish genuine 5′ ends from incomplete cDNAs. We developed a transcriptomic method based on sequencing of cDNA enriched for full-length fragments and an unenriched control. From the mapped sequence reads, enrichment scores are calculated for all transcribed nucleotides and a statistical model of the enrichment constructed. We tested the method in the human malaria parasite Plasmodium falciparum. Data were obtained from ring, trophozoite and schizont stages of the parasite intra-erythrocytic development cycle. Two groups of 5′ capped nucleotides were assigned by unsupervised clustering. The first group contains sites located mostly outside of annotated protein-coding exons in regions of high local nucleosomal occupancy, but low occupancies of ribosome and elongating RNA polymerase II. The majority of sites in the second group are intra-exonic and show different patterns, most notably a peak of ribosome occupancy centered on the 5′ end position and a biased representation among codons possibly prone to ribosome stalling. Our method can be used to annotate 5′ capped nucleotides, including intra-exonic nucleotides that can be distinguished from incomplete cDNA artifacts.

2021-08-02 | GSE103036 | GEO

Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria

Project description:The complexity and intricacy of prokaryotic transcriptomes—once deemed well understood and simple—are increasingly being discovered and appreciated. The ability to determine full-length sequences of all transcripts in the cell is essential for understanding the gene regulatory repertoire of a species. Standard RNA-seq requires fragmentation of RNA for short-read sequencing, which automatically decouples the 5' sequence of a RNA molecule from its 3' sequence. Intramolecular ligation of 5' and 3' ends represents a potential strategy for simultaneously capturing the sequences of both termini. However, counterintuitively, it is more challenging to circularize prokaryotic transcripts than eukaryotic ones due to a lack of poly(A) tails. Consequently, a method capable of comprehensively profiling full-length transcripts in prokaryotes is still urgently needed. In this work, we developed a workflow, termed SEnd-seq, that simultaneously reads both ends of all bacterial RNAs—including small non-coding RNAs—with single-nucleotide resolution. This method enabled us for the first time to determine the correlated occurrence of transcription start sites (TSS) and termination sites (TTS) across the whole transcriptome, and achieve an unprecedented map of its operon architecture. Using E. coli as a model system, we identified thousands of new TSS and TTS, many of which were found to be condition dependent. These results significantly expand our knowledge of the regulatory elements existing in the E. coli genome and improve our understanding of many aspects of bacterial RNA metabolism.

2019-05-19 | GSE117737 | GEO

Full-length RNA-seq of short RNAs from Cuscuta campestris

Project description:Cuscuta campestris is an obligate parasitic plant that attaches to the stems of host plants to obtain water and nutrients. C. campestris produces a specialized set of microRNAs specifically at the host-parasite interface. Many of these interface-induced microRNAs target mRNAs from the host. This experiment was designed to capture full-length primary transcripts that give rise to C. campestris interface-induced microRNAs. C. campestris shoot tips were stimulated to produce haustoria, then harvested to extract total RNA. RNA was then treated with various enzymes to modify 5' ends. Libraries were then made and sequenced. Importantly the library method only captures RNAs with a 5'-monophosphate. Therefore the specific enzymatic treatments can reveal the native 5' ends of the sequenced RNAs. Data were used to identify the primary transcripts for many of the known C. campestris primary microRNA transcripts. The data were also interrogated to tally specific snRNAs (U1, U2, U4, and U5) that are known to have a 2,2,7mGppp cap, and the tally pre-tRNAs, which are known to have a ppp 5' end. The analyzed results indicated that C. campestris interface-induced microRNA primary transcripts likely have a 5' ppp, not a cap, consistent with transcription by RNA polymerase III. The analysis also demonstrated that C. campestris interface-induced microRNA primary transcripts mostly terminate within stretches of polyT and lack polyA tails, also features consistent with Pol III transcription. Finally, the analysis indicated that the transcriptional start sites were located ~ 55 bp downstream of a common ten-base pair promoter element (the upstream sequence element). The 55bp spacing is also consistent with Pol III transcription.

2023-01-03 | GSE221347 | GEO

Full-length mRNA sequencing reveals principles of poly(A) tail length control

Project description:We report FLAM-seq, a cDNA library preparation method coupled to PacBio single-molecule sequencing for profiling full-length mRNAs including their poly(A) tail.

2019-06-04 | GSE126465 | GEO

Proteome validation for novel full-length genes in the giant panda

Project description:we applied RNA-seq to detect novel expressed transcripts in 12 tissues of giant pandas, using a transcriptome reconstruction strategy combining reference-based and de novo methods. Then we used mass spectrometry method to identify proteomes of five selected tissues, aiming at validating these novel full-length genes we identified.

2015-12-23 | PXD002917 | Pride

TLDR (True Length of Diverse capped RNAs)-seq: a method for 5’-to-3’ end sequencing of capped full-length RNAs with or without 3’ polyadenylation

Project description:TLDR (True Length of Diverse capped RNAs)-seq: a method for 5’-to-3’ end sequencing of capped full-length RNAs with or without 3’ polyadenylation

| PRJNA1170942 | ENA

Full-length Sequencing of Non-capped RNAs Reveals the Heterogeneity of RNA Processing and Novel Classes of Noncoding RNAs

Project description:Purpose:Up to 80% of the human genome gives rise to “dark matter” RNAs that mainly composes of non-capped RNAs (napRNAs). However, determining the functional impacts and metabolisms of the napRNAs requires identification of their full-length sequences. Method:We developed an approach to globally profile the full-length sequences of napRNAs at single-nucleotide resolution Results:We discovered, for the first time, the stable expressed linear intron RNA (sliRNA), a novel class of snoRNA-intron (snotron) RNAs, a new class of RNA embedded in miRNA spacers (misRNA) and thousands of new exceptional structured ncRNAs and repeat-derived ncRNAs (repeatRNA) in humans and mouse. Importantly, these new napRNAs are dynamic changes in response to various stimuli and biological processes, suggesting that they have potential regulatory functions. Furthermore, we show that functional napRNA FS4, discovered by NAP-seq firstly, promotes HepG2 cell proliferation by interacting with DKC1 to maintain the protein stability. Conclusion:Collectively, our approach establishes a paradigm for mapping and annotating novel class of ncRNAs of many living species.

2024-02-19 | GSE228168 | GEO

Baiting out a full length sequence from unmapped RNA-seq data

Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.

2021-04-22 | GSE172487 | GEO

Novel method for multiplexed full-length single-molecule sequencing of the human mitochondrial genome

Project description:Here we describe a method to target, multiplex and sequence full-length, native single-molecule the human mitochondrial genome utilizing the RNA-guided DNA endonuclease Cas9.

| EGAS00001006203 | EGA

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data