Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

ABSTRACT: A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555

ORGANISM(S): Danio rerio

PROVIDER: GSE34508 | GEO | 2011/12/17

SECONDARY ACCESSION(S): PRJNA156329

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

Project description:A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555 Two-condition experiment, slc2a10 MO (7.5ng) treatment vs control MO (5ng) treatment. Biological replicates: 3 slc2a10 MO replicates, compared to a pooled sample of 3 control MO replicates with dye swap.

2011-12-17 | E-GEOD-34508 | biostudies-arrayexpress

TGFb receptor 1 (TGFBR1) inhibitor treatment of zebrafish embryos vs. controls

2011-12-17 | GSE34509 | GEO

TGFb receptor 1 (TGFBR1) inhibitor treatment of zebrafish embryos vs. controls

Project description:The effect of transforming growth factor beta receptor 1 (TGFBR1) inhibitor (LY-364947) treatment was compared to untreated embryos. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555 Two-condition experiment, LY-364947 (40microM) treatment vs untreated controls. Biological replicates: 3 LY-364947 treatment replicates compared to a pooled sample of 3 untreated control replicates with dye swap.

2011-12-17 | E-GEOD-34509 | biostudies-arrayexpress

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Microarray expression data from three arterial tortuosity syndrome (ATS) patients' skin fibroblasts with recessive SLC2A10 mutations

Project description:To screen for candidate genes that may contribute to the pathogenesis of ATS Transcriptome-wide expression profiling using the Affymetrix Gene 1.0 ST platform comparing the gene expression patterns of skin fibroblasts of three ATS patients with those of three healthy individuals

2015-09-21 | GSE70683 | GEO

microRNA expression profiles from three arterial tortuosity syndrome (ATS) patients' skin fibroblasts with recessive SLC2A10 mutations [miRNA]

Project description:To screen for potential miRNA that may contribute to the pathomechanisms of ATS miRNA expression profiling using the Affymetrix GeneChip® miRNA 3.0 Array comparing the miRNA expression changes of skin fibroblasts of three ATS patients with those of three healthy individuals

2015-09-21 | GSE71172 | GEO

Microarray expression data from three arterial tortuosity syndrome (ATS) patients' skin fibroblasts with recessive SLC2A10 mutations

2015-09-21 | E-GEOD-70683 | biostudies-arrayexpress

microRNA expression profiles from three arterial tortuosity syndrome (ATS) patients' skin fibroblasts with recessive SLC2A10 mutations [miRNA]

2015-09-21 | E-GEOD-71172 | biostudies-arrayexpress

YAMAT-seq of mature tRNA pools in the bacterium Escherichia coli str. K-12 substr. MG1655 and derivatives

Project description:Mature tRNA pools were measured using an adaptation of YAMAT-seq (Shigematsu et al., 2017; doi:10.1093/nar/gkx005 ) and further described in (Ayan et al., 2020; doi:10.7554/eLife.57947) in 10 strain-medium combinations (all strains dervied from the model bacterium E. coli MG1655). The aim of the experiment was to investigate the effect of reducing tRNA gene copy number on mature tRNA pools in rich and poor media.

2022-12-02 | GSE198606 | GEO

Gene expression changes in stage 23 Xenopus laevis embryos upon Neil2 knockdown

Project description:It was shown that neil2 is required for neural crest development in Xenopus (Schomacher et al. 2016; doi:10.1038/nsmb.3151). To gain further insights into the underlying molecular mechanism leading to neural crest defects and microcephaly in neil2 Morpholino injected Xenopus embryos, we performed RNA-seq transcriptome analysis of neil2 Morpholino versus control Morpholino injected embryos.

2019-09-16 | GSE130079 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data