Gene expression signatures in miR-29c overexpressed gastric cancer cells.
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE38581 | GEO | 2013/03/27
SECONDARY ACCESSION(S): PRJNA168160
REPOSITORIES: GEO
Similar Datasets
Project description:To explain the mechanism that miR-29c affects the cell proliferation, we attempted to identify the miR-29c target genes in gastric carcinoma. The expression profiles in MKN45, MKN7 and MKN74 cells transfected with miR-29c oligo or Negative control oligo were obtained from microarray analysis. Then, the genes differentially expressed (Fold change >= 2.0) in miR-29c-transfected cells compared with negative control-transfected ones were identified in each cell lines, respectively. The differentially expressed genes shared among 3 cell lines were identified as the candidates for miR-29c targets. Human gastric cancer cell lines, MKN45, MKN74 and MKN7 were transfected with miR-29c oligo or negative control oligo (n=2) (Ambion). At 24h after, total RNA was extracted and microarray analysis was performed. The genes with common expression changes among three cell lines miR-29c-transfected were identified as the candidates for miR-29c targets.
2013-03-27 | E-GEOD-38581 | biostudies-arrayexpress
Project description:Purpose: to detect expression profile of differentially expressed mRNAs during bovine mammary epithelial cells line (MAC-T) transfected with miR-29c inhibitor or negative control (NC) inhibitor in vitro. Methods: bovine mammary epithelial cells were transfected with miR-29c inhibitor or negative control (NC) inhibitor to assess the expression profiles of mRNAs using RNA-seq. Results: a total of 42 up-regulated and 27 down-regulated mRNAs were found in the miR-29c inhibitor transfected group compared with the NC inhibitor group. Conclusion: the inhibition of miR-29c in MAC-T cells could lead to the up-regulation of 42 mRNAs and the down-regulation of 27 mRNAs. The functional enrichment of the differentially expressed mRNAs indicated that miR-29c might be a potential regulator of oxidative stress and inflammatory response in MAC-T through multiple genes, such as FOXO1, TNF-α and BoLA-DQA5, which enriched in stress-activated MAPK cascade, Epstein-Barr virus infection and inflammatory bowel disease signaling pathways. The above results imply that miR-29c plays an important role in the steady state of bMECs or bovine mammary glands and may be a potential therapeutic target for mastitis in dairy cows.
2022-04-20 | GSE195508 | GEO
Project description:While the basal-like subtype accounts for only a small subset of all breast cancer cases, it is associated with the worst prognosis. The majority of basal-like tumors are triple-negative (ER-, PR-, and HER2-negative), and thus lack molecular targets for therapy. To identify potential molecular markers and/or pathways that are critical to the basal-like tumor phenotype, we investigated the deregulation of microRNAs in primary breast tumors from an ethnically diverse cohort of patients. Forty-four microRNAs were identified as down-regulated in basal-like tumors compared to luminal-A tumors. MicroRNA-29c (miR-29c) was the most significantly down-regulated microRNA. In breast cancer cells in vitro, miR-29c was capable of regulating phenotypes associated with basal-like tumors such as cell invasion and drug sensitivity. Exogenous expression of miR-29c sensitizes UACC 3199 to doxorubicin-induced killing, while its inhibition leads to resistance to doxorubicin-induced killing. In addition, miR-29c decreases invasiveness of UACC-3199 cells, along with down-regulation of extracellular matrix (ECM) genes (LAMC1 and COL5A2) and ECM modifying enzyme LOXL2. In addition, miR-29c directly regulates B-MYB, an oncogene over expressed in basal-like tumors and co-expression of miR-29c and B-MYB abolishes UACC 3199 sensitivity to doxorubicin. Furthermore, our work demonstrates a regulatory role for the transcription factor GATA3 in miR-29c expression in breast cancer. Our findings support a role for miR-29c in basal-like breast tumorigenesis that is linked to drug resistance.
2015-12-22 | GSE38951 | GEO
Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.
2020-01-20 | GSE94070 | GEO
Project description:MicroRNAs (miRNAs) are small regulatory RNA molecules that modulate the activity of specific mRNA targets and play important roles in a wide range of physiologic and pathologic processes. We hypothesized that miRNAs might be involved in the progression of CKD. In our previous studies we found chronic renal damages developed progressively in rats with 5/6 nephrectomy. L-mimosine(L-Mim) intervention from wk 5 to wk 12 improved renal function and resulted in additional accumulation of HIF-1 α and -2 α at wk 12. In the current study we found miR-29c was up-regulated in the L-Mim treated group compared with the control using Agilent miRNA microarrays. Of the microRNAs and proteins that exhibited reciprocal changes in expression following the L-Mim treatment, miR-29c and tropomyosin 1α (TPM1), which is involved in stress fiber function, met the sequence criteria for microRNA-target interaction, were later confirmed by 3'-untranslated region reporter analysis. TGFβ1 treatment (3 ng/ml, 24 hours) decreased miR-29c expression and up-regulated protein expression of TPM1 in human renal epithelial cells. Overexpression of miR-29c significantly attenuated TGF-β1 induced increase in TPM1 in vitro. Moreover, intrarenal expression of miR-29c was decreased in IgAN patients with moderate to severe tubulointerstital fibrosis (TIF), compared with IgAN patients without TIF, and intrarenal protein expression of TMP1 was significantly increased in IgAN patients with TIF. The results suggest that intrarenal expression of miR-29c was down-regulated while its predicted target, TPM1 was up-regulated in the progression of CKD. Short term stabilizing of HIF up-regulates miR-29c and attenuates CKD in the remnant kidney model.
2013-01-08 | GSE28471 | GEO
Project description:MicroRNAs (miRNAs) are small regulatory RNA molecules that modulate the activity of specific mRNA targets and play important roles in a wide range of physiologic and pathologic processes. We hypothesized that miRNAs might be involved in the progression of CKD. In our previous studies we found chronic renal damages developed progressively in rats with 5/6 nephrectomy. L-mimosine(L-Mim) intervention from wk 5 to wk 12 improved renal function and resulted in additional accumulation of HIF-1 M-NM-1 and -2 M-NM-1 at wk 12. In the current study we found miR-29c was up-regulated in the L-Mim treated group compared with the control using Agilent miRNA microarrays. Of the microRNAs and proteins that exhibited reciprocal changes in expression following the L-Mim treatment, miR-29c and tropomyosin 1M-NM-1 (TPM1), which is involved in stress fiber function, met the sequence criteria for microRNA-target interaction, were later confirmed by 3'-untranslated region reporter analysis. TGFM-NM-21 treatment (3 ng/ml, 24 hours) decreased miR-29c expression and up-regulated protein expression of TPM1 in human renal epithelial cells. Overexpression of miR-29c significantly attenuated TGF-M-NM-21 induced increase in TPM1 in vitro. Moreover, intrarenal expression of miR-29c was decreased in IgAN patients with moderate to severe tubulointerstital fibrosis (TIF), compared with IgAN patients without TIF, and intrarenal protein expression of TMP1 was significantly increased in IgAN patients with TIF. The results suggest that intrarenal expression of miR-29c was down-regulated while its predicted target, TPM1 was up-regulated in the progression of CKD. Short term stabilizing of HIF up-regulates miR-29c and attenuates CKD in the remnant kidney model. Four weeks after 5/6 nephrectomy, rats were treated with intraperitoneal injections of vehicle or L-mimosine (L-Mim, Calbiochem), a prolyl 4-hydroxylase inhibitor (PHD), at a dosage of 50 mg/kg every other day. At the end of wk 12 after 5/6 nephrectomy, all rats (n=4, for each group) were sacrificed and blood samples were collected via cardiac puncture. Renal tissue were harvested, one piece of which was fixed in neutral formalin and then embedded in paraffin. The remaining kidney tissue was dissected in ice-cold PBS to, remove medulla, and then snap-frozen in liquid nitrogen before transferring to storage at -80M-BM-0C until further analysis.
2013-01-08 | E-GEOD-28471 | biostudies-arrayexpress
Project description:Little is understood about the early molecular drivers of triple-negative breast cancer (TNBC), making the identification of women at risk and development of targeted therapy for prevention significant challenges. By sequencing a TNBC cell line-based breast cancer progression model we have found that miRNA-29c is progressively lost during TNBC tumorigenesis. In support of the tumor suppressive role of miRNA 29c, we found that low levels predict poor overall patient survival and, conversely, that ectopic expression of miRNA-29c in preneoplastic cell models inhibits growth. miRNA-29c exerts its growth inhibitory effects through direct binding and regulation of TGFB-induced factor homeobox 2 (TGIF2), CAMP-responsive element binding protein 5 (CREB5), and V-Akt murine thymoma viral oncogene homolog 3 (AKT3). miRNA-29c regulation of these gene targets seems to be functionally relevant, as TGIF2, CREB5, and AKT3 were able to rescue the inhibition of cell proliferation and colony formation caused by ectopic expression of miRNA-29c in preneoplastic cells. AKT3 is an oncogene of known relevance in breast cancer, and as a proof of principle we found that inhibition of phosphoinositide 3-kinase (PI3K) activity, a protein upstream of AKT3, suppressed proliferation in TNBC preneoplastic cells. We explored additional opportunities for prevention of TNBC by studying the regulation of miRNA-29c and identified DNA methylation to have a role in the inhibition of miRNA-29c during TNBC tumorigenesis. Consistent with these observations, we found 5 aza-cytadine to relieve the suppression of miRNA-29c. Together, these results demonstrate that miRNA-29c loss plays a key role in the early development of TNBC.
2017-01-18 | GSE93740 | GEO
Project description:Three metastatic melanoma cell lines (BD-0548-ME, DP-0574-ME and WP-0614-ME) were transfected with miR precursors: hsa-miR negative control (NC) or hsa-miR-200a-3p precursors (miR-200a). The objective of this experiment was to determine miR-200a targets in metastatic melanoma cell lines. We selected low -miR-200a expression cell lines and then we overexpressed miR-200a or NC. Finally, we compared the metastatic melanoma cell lines with miR-200a overexpression (miR-200a) to the same cell line transfected with the negative control miR (NC).
2018-06-20 | GSE83512 | GEO
Project description:To investigate the mechanisms of miR-1 inducing apoptosis, we performed cDNA expression microarray analysis to identify the candidate miR-1 regulating genes that are involved in apoptosis. NPC-TW01 cells were transfected with miR-1 or miR-negative control for 40 hours, their total RNA were isolated from the cells and hybridized to an Agilent human whole genome oligo 4 x 44 K microarray. HeLa cells were transfected with miR-1 or miR-negative control for 40 hours, their total RNA were isolated from the cells and hybridized to an Agilent human whole genome oligo 4 x 44 K microarray.
2011-04-13 | E-GEOD-28522 | biostudies-arrayexpress
Project description:To clarify the role of miR-199a-3p in HCC, we carried out a gene expression microarray analysis using HCC cell lines (HLE and HLF) transfected with a miR-199a-3p mimic or a negative control. We found that 819 genes were downregulated (>2-fold) by miR-199a-3p in both cell lines.
2018-09-23 | GSE110216 | GEO