Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Near naked hairless, Hr(n), and Hr(Rh-R) mice

ABSTRACT: This SuperSeries is composed of the SubSeries listed below.

ORGANISM(S): Mus musculus

PROVIDER: GSE4059 | GEO | 2006/04/18

SECONDARY ACCESSION(S): PRJNA95203

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Near naked hairless, Hr(n), and Hr(Rh-R) mice

Project description:This SuperSeries is composed of the following subset Series: GSE4052: Near Naked Hairless mouse skin array GSE4053: ORNL 5wk Hr(n)/+ mice skin array GSE4055: ORNL Hr(Rh-R) mouse cutaneous array Keywords: SuperSeries Refer to individual Series

2010-07-01 | E-GEOD-4059 | biostudies-arrayexpress

Near Naked Hairless mouse skin array

2006-04-18 | GSE4052 | GEO

Gene expression profiles in dorsal skin of hairless mice orally administrated collagen hydrolysate

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2015-06-12 | E-GEOD-62650 | biostudies-arrayexpress

Near Naked Hairless mouse skin array

Project description:This is the data from 7 day-old homozygous Hrn mutant mice compared to the wild type mice with mouse 22k compugen oligolibrary 2.0. The data was normalized with GeneSight from BioDiscovery and analyzed with SAM. Keywords: Genetic mutant 7 day-old near naked hairless mutant mice vs 7 day-old wild type mice. Five biological replicates were used from one litter. Dye-swapping was done to remove dye-specific errors

2010-07-01 | E-GEOD-4052 | biostudies-arrayexpress

Gene expression profiles in dorsal skin of hairless mice orally administrated collagen hydrolysate

Project description:This SuperSeries is composed of the SubSeries listed below.

2015-06-12 | GSE62650 | GEO

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

Project description:We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

| S-EPMC4160947 | biostudies-literature