Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Potential capacity of aptamers to trigger immune activation in human blood

ABSTRACT: Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics.

ORGANISM(S): Homo sapiens

PROVIDER: GSE46676 | GEO | 2013/05/07

SECONDARY ACCESSION(S): PRJNA201491

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Potential capacity of aptamers to trigger immune activation in human blood

Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37Â°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics. To evaluate the influence of synthetic ssDNA oligonucleotides (SB_ODN, CpG_ODN) on the cells of circulating peripheral blood (n=3), the samples were divided into 7 groups, 0h_without ssDNA, 2h_without ssDNA, 2h_with SB_ODN, 2h_with CpG_ODN, 4h_without ssDNA, 4h_with SB_ODN, 4h_with CpG_ODN. Baseline value samples (0h_without ssDNA) were obtained after blood collection without rotating in the closed-loop model. Negative control samples (2h_without ssDNA and 4h_without ssDNA) did not include oligonucleotides but rotated in the closed-loop model.

2013-05-07 | E-GEOD-46676 | biostudies-arrayexpress

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

| PRJNA564266 | ENA

Coagulation Factor XIII-Binding Aptamers as Bivalent Ligands Targeting Fibrin and Activated Platelets in the Thrombus

Project description:Thromboembolic diseases are commonly associated with thrombus-induced ischemia and tissue damage; identification of the location of the thrombus, or thrombus-targeting, may facilitate diagnosis and target therapy. We hypothesized that aptamers with high affinity and specificity for coagulation factor XIII (FXIII) can serve as thrombus-targeting probes. With systematic evolution of ligands by exponential enrichment technology and semi-activated FXIII (FXIII’) as the target, guanine-rich FXIII’-binding aptamers (FAs; 76 nt) were selected from a library of single-stranded DNA. Next generation sequencing identified FAs with the highest frequency; bio-layer interferometry revealed a dissociation constant (Kd) from 0.7 to 2.5 nM. Truncation with preservation of a conserved region based on entropy analysis resulted in three truncated FAs (FATs; 41-47 nt) that exhibited 4-fold signal in binding to activated vs. resting platelets, as determined by flowcytometry. In addition, FAT2 exhibited up to 4.2-fold binding of that from scrambled ssDNA to platelet/fibrin clot or whole blood clot in vitro, suggesting binding to both activated plateltes and fibrin. FAT2 also exhibited targeting effects in a microcirculatory thrombosis model in mice. Nevertheless, FATs induced no effect on blood coagulation, as determined by thromboelastometry. In conclusion, FXIII-binding aptamers are potentially amenable to thrombus targeting in theranostic application of thromboembolic diseases.

2023-12-28 | GSE163934 | GEO

Gene network landscape of murine splenocytes reveals integrin as the A151 ODN-responsive hub in immune transcriptome

Project description:PURPOSE: Homeostatic restoration of an inflammatory response requires quenching of the immune system after pathogen threats vanish. A continued assault orchestrated by host defense results in tissue destruction or autoimmunity. A151 is the epitome of synthetic oligodeoxynucleotides (ODNs) that curb immune response by a subset of white corpuscles through repetitive telomere derived TTAGGG sequences. Nevertheless, the genuine effect A151 has on immune cell transcriptome still remains unknown. METHODS: We leveraged an integrative approach in which weighted gene co-expression network analysis (WGCNA) and differential gene expression analysis of our in-house microarray data sets aided our understanding of how A151 ODN suppresses immune response in mouse splenocytes. We fed raw gene expression data from two different (scrambled ODN and A151 ODN) treatment groups with a varying number of replicate arrays (29 and 16, respectively) into WGCNA, limma, and GSEA separetely to understand different dimensions of the A151 ODN-driven immune modulation at the transcriptome level. RESULTS: Together with experimental and in silico validations, we demonstrated that A151 ODN acts on components of integrin complexes, namely Itgam and Itga6, to interfere with immune cell adhesion, and thereby, suppress the immune response in mouse. Furthermore, we revealed that cell adhesion by integrin complexes serves as a focal point for cellular response to A151 ODN treatment in immune cells. CONCLUSION: A refined set of co-hub genes led by Itgam and Itga6 plays a pivotal role in A151 ODN-driven suppression of immune response. Also, A151 ODN treatment appears to interfere with immune cell adhesion to quench immune response in mouse splenocytes. The outcome of this study sheds light on the molecular basis of immune suppression by a clinically useful DNA-based therapeutic agent and may open new revenues for A151 ODN research.

2021-10-01 | GSE184994 | GEO

DNA aptamers that modulate biological activity of model neurons

Project description:There is an urgent need for agents that promote health and regeneration of cells and tissues, specifically to treat diseases of the aging nervous system. Age-associated nervous system degeneration and various diseases are driven by many different biochemical stresses, often making it difficult to target any one disease cause. Our laboratory has previously identified DNA aptamers with apparent regenerative properties in murine models of multiple sclerosis by selecting aptamers that bind oligodendrocyte membrane preparations. Here, we selected from vast libraries of molecules (~1014 unique DNAs) those with the ability to bind cultured human SH-SY5Y neuroblastoma cells as a neuronal model, followed by screening for aptamers capable of eliciting biological responses, with validation of binding in differentiated SH-SY5Y, human iPSC-derived sensory neurons, and hESC derived cortical neurons. This demonstrates a proof-of-concept workflow to identify biologically active aptamers by cycles of cell selection.

2024-11-11 | GSE278187 | GEO

Type I Interferon Dependent Anti-viral Activity

Project description:Synthetic oligonucleotides (ODN) expressing CpG motifs trigger an innate immune response via TLR9. Multiple microarray analyses were performed to identify the global effects on gene expression of stimulating the CAL-1 human pDC line with different types of CpG ODN. Results show that a subset of genes characterized by shared anti-viral activity was consistently up-regulated by ODNs that otherwise mediate discrete functions. This group of genes was largely dependant on autocrine type I interferon (IFN) signaling, as their induction was blocked by neutralizing antibody targeting the type I IFN receptor. Coupling these experiments with a meta-analysis of other published works led to the identification of a set of 32 functionally conserved genes that was reproducibly activated by different types of CpG DNA in different species and cell types. Functionally, these 'core' genes support a type I IFN response to viral infection, and differ from genes up-regulated by only a single type of CpG ODN. These findings help define the conserved and sequence-specific patterns of gene activation triggered via TLR9 and improve our understanding of the immunomodulatory effects elicited by CpG ODN.

2012-07-01 | GSE30849 | GEO

DNA aptamers for detection of pyoverdine pf5

Project description:The rhizosphere is a small region surrounding plant roots that is enriched in biochemicals from root exudates and populated with fungi, nematode, and bacteria. Interaction of rhizosphere organisms with plants is mainly promoted by exudates from the roots. Root exudates contain biochemicals that come from primary and secondary metabolisms of plants. These biochemicals attract microbes, which influence plant nutrition. The rhizosphere bacteria (microbiome) are vital to plant nutrient uptake and influence biotic and abiotic stress and pathogenesis. Pseudomonas is a genus of gammaproteobacteria known for its ubiquitous presence in natural habitats and its striking ecological, metabolic, and biochemical diversity. Within the genus, members of the Pseudomonas fluorescens group are common inhabitants of soil and plant surfaces, and certain strains function in the biological control of plant disease, protecting plants from infection by soilborne and aerial plant pathogens. The soil bacterium Pseudomonas protegens Pf-5 (also known as Pseudomonas fluorescens Pf-5) is a well-characterized biological strain, which is distinguished by its prolific production of the secondary metabolite, pyoverdine. Knowledge of the distribution of P. fluorescens secretory activity around plant roots is very important for understanding the interaction between P. fluorescens and plants and can be achieved by real time tracking of pyoverdine. To achieve the capability of real-time tracking in soil, we have used a structure-switching SELEX strategy to select high affinity ssDNA aptamers with specificity for pyoverdine over other siderophores. Two DNA aptamers were isolated, and their features compared. The aptamers were applied to a nanoporous aluminum oxide biosensor and demonstrated to successfully detect PYO-Pf5. This sensor provides a future opportunity to track the locations around plant roots of P. protegens and to monitor PYO-Pf5 production and movement through the soil.

2024-07-18 | GSE225440 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

| PRJNA514043 | ENA