Gene expression profiling of prostate cancer cells upon JMJD2A or ETV1 knockdown
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE47750 | GEO | 2014/01/01
SECONDARY ACCESSION(S): PRJNA207662
REPOSITORIES: GEO
Similar Datasets
Project description:Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells. Total RNA was isolated from transformed LNCaP human prostate cancer cells containing a non-trageting control vector (sh-cm), vectors containing shRNA sequences for JMJD2A or ETV1 genes.
2014-01-01 | E-GEOD-47750 | biostudies-arrayexpress
Project description:JMJD2A was chromatin immunoprecipitated from HEK293T cells overexpressing GFP-JMJD2A. From Van Rechem et al. 2011 JBC
2013-08-01 | GSE48765 | GEO
Project description:Cardiac hypertrophy and failure are accompanied by a reprogramming of gene expression that involves transcription factors and chromatin remodeling enzymes. Little is known about the role of histone methylation and demethylation in this process. To understand the role of JMJD2A, a trimethyl demethylase for histone 3 lysine 9 and 36, in cardiac hypertrophy, we generated heart specific JMJD2A deletion (JMJD2A hKO) and overexpression (JMJD2A-Tg) mouse lines. JMJD2A hKO and JMJD2A-Tg mice are viable and have no overt baseline phenotype. However, they have altered responses to cardiac stresses. While inactivation of JMJD2A in hKO mice resulted in an attenuated hypertrophic response to transverse aortic constriction (TAC)-induced pressure overload compared to that of control littermates, JMJD2A-Tg mice have exacerbated cardiac hypertrophy after TAC.
2021-09-26 | GSE169645 | GEO
Project description:JMJD2A was chromatin immunoprecipitated from HEK293T cells overexpressing GFP-JMJD2A. From Van Rechem et al. 2011 JBC Determination of JMJD2A binding sites by MA2C analysis
2013-08-01 | E-GEOD-48765 | biostudies-arrayexpress
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress
Project description:Here we reported the Jmjd2a and Jmjd2c are co-targeted at the essential genes of mouse activating B220+ B cells. B cell activation programs transcription networks that subsequently induce plasma cell differentiation, but how histone demethylases participating in this process remains elusive. We found that histone demethylases Jmjd2a and Jmjd2c are expressed in Tfh-mediated signals stimulated mouse spelenic B220+ B cells. we then perform ChIP-seq by using anti-Jmjd2a and anti-Jmjd2c antibodies to identified the genes regulated by Jmjd2a and Jmjd2c and required for correct activation.
2020-01-01 | GSE99365 | GEO
Project description:Base on the privious studie from our lab, we found the histone demethylases, Jmjd2a and Jmjd2c are upregulated in stimulated primary B cells, depletion of Jmjd2a and Jmjd2c in stimulated B cells resulted in failed activation of B cells. Owimg to the essential functions of Jmjd2a and Jmjd2c, We here applied loss of function approach, such as siRNA, to study the how Jmjd2a and Jmjd2c regulate plasma cell differentiation.
2020-01-01 | GSE99750 | GEO
Project description:Cardiac hypertrophy and failure are accompanied by a reprogramming of gene expression that involves transcription factors and chromatin remodeling enzymes. Little is known about the role of histone methylation and demethylation in this process. To understand the role of JMJD2A, a trimethyl demethylase for histone 3 lysine 9 and 36, in cardiac hypertrophy, we generated heart specific JMJD2A deletion (JMJD2A hKO) and overexpression (JMJD2A-Tg) mouse lines. JMJD2A hKO and JMJD2A-Tg mice are viable and have no overt baseline phenotype. However, they have altered responses to cardiac stresses. While inactivation of JMJD2A in hKO mice resulted in an attenuated hypertrophic response to transverse aortic constriction (TAC)-induced pressure overload compared to that of control littermates, JMJD2A-Tg mice have exacerbated cardiac hypertrophy after TAC. We identified four-and-a-half LIM domains 1 (FHL1) as a novel target of JMJD2A. JMJD2A binds to the FHL1 promoter in response to TAC and upregulates the expression of FHL1. Binding of JMJD2A to the FHL1 promoter is associated with downregulation of trimethylated H3K9. Upregulation of FHL1 by JMJD2A is mediated through SRF and myocardin, and requires its demethylase activity. The expression of JMJD2A is upregulated in human hypertrophic cardiomyopathy patients. Our studies reveal that JMJD2A promotes cardiac hypertrophy by synergistically upregulating SRF/myocardin-targeted genes and suggest a novel mechanism of reprogramming of gene expression involved in cardiac hypertrophy.
2011-06-02 | GSE27689 | GEO
Project description:Histone demethylase upregulation has been observed in human cancers, yet it is unknown whether this is a bystander event or a driver of tumorigenesis. We found that overexpression of lysine-specific demethylase 4A (KDM4A, also known as JMJD2A) was positively correlated with Gleason score and metastasis in human prostate tumors. Overexpression of JMJD2A resulted in the development of prostatic intraepithelial neoplasia in mice, demonstrating that JMJD2A can initiate prostate cancer development. Moreover, combined overexpression of JMJD2A and the ETS transcription factor ETV1, a JMJD2A-binding protein, resulted in prostate carcinoma formation in mice haplodeficient for the phosphatase and tensin homolog (Pten) tumor-suppressor gene. Additionally, JMJD2A cooperated with ETV1 to increase expression of yes associated protein 1 (YAP1), a Hippo pathway component that itself was associated with prostate tumor aggressiveness. ETV1 facilitated the recruitment of JMJD2A to the YAP1 promoter, leading to changes in histone lysine methylation in a human prostate cancer cell line. Further, YAP1 expression largely rescued the growth inhibitory effects of JMJD2A depletion in prostate cancer cells, indicating that YAP1 is a downstream effector of JMJD2A. Taken together, these data reveal a JMJD2A/ETV1/YAP1 axis that promotes prostate cancer initiation and that may be a suitable target for therapeutic inhibition.
| S-EPMC4731184 | biostudies-literature
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
2013-05-10 | GSE46329 | GEO