Resistance mechanisms to SYK inhibition in AML
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE129698 | GEO | 2020/01/16
REPOSITORIES: GEO
Similar Datasets
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
2014-01-15 | GSE54065 | GEO
Project description:Resistance mechanisms to SYK inhibition in AML
| PRJNA532524 | ENA
Project description:Neuroblastoma (NB) is considered an immunologically cold tumor and is usually less responsive to immune checkpoint blockade (ICB). Tumor-associated macrophages (TAMs) are highly infiltrated in NB tumors and promote immune escape and resistance to ICB. Hence therapeutic strategies targeting immunosuppressive TAMs can improve responses to ICB in NB. We recently discovered that spleen tyrosine kinase (Syk) reprograms TAMs toward an immunostimulatory phenotype and enhances T-cell responses in the lung adenocarcinoma model. Here we investigated if Syk is an immune-oncology target in NB and tested whether a novel immunotherapeutic approach utilizing Syk inhibitor together with radiation and ICB could provide a durable antitumor immune response in an MYCN amplified murine model of NB. Myeloid Syk KO mice and syngeneic MYCN-amplified cell lines were used to elucidate the effect of myeloid Syk on the NB tumor microenvironment (TME). In addition, the effect of Syk inhibitor, R788, on anti-tumor immunity alone or combination with anti-PDL1 mAb and radiation was also determined in murine NB models. The underlying mechanism of action of this novel therapeutic combination was also investigated. Herein, we report that Syk is a marker of NB -associated macrophages and plays a crucial role in promoting immunosuppression in the NB TME. We found that the blockade of Syk in NB-bearing mice markedly impairs tumor growth. This effect is facilitated by macrophages that become immunogenic in the absence of Syk, skewing the suppressive TME towards immunostimulation and activating anti-tumor immune responses. Moreover, combining FDA-approved Syk inhibitor, R788 (fostamatinib) along with anti-PDL1 mAb provides a synergistic effect leading to complete tumor regression and durable anti-tumor immunity in mice bearing small tumors (50 mm3) but not larger tumors (250 mm3). However, combining radiation to R788 and anti-PDL1 mAb prolongs the survival of mice bearing large NB9464 tumors.
2023-06-02 | GSE224021 | GEO
Project description:Background: Among all gynecologic malignancies, epithelial ovarian cancer has the highest case-to-fatality ratio. Most patients are diagnosed at advanced stages and recurrence is common and accounts for disease-related mortality. Spleen tyrosine kinase (SYK) is an emerging cancer-associated kinase upregulated in recurrent tumors and is amenable for inhibition using small compounds that have been studied in clinical trials for autoimmune diseases. Our previous proteomic analysis identified several novel SYK substrates including EGFR and ERBB2. Here, we investigated the cross-talk between these pathways in ovarian carcinomas. Methods: Immunohistochemistry and immunoblotting were utilized to assess SYK and EGFR phosphorylation in ovarian serous carcinomas. Association with survival was determined by Kaplan-Meier analysis and the log-rank test. To study its role in EGFR signaling, SYK activity was modulated using a small molecule inhibitor, a syngeneic knockout, and an active kinase inducible system. We applied RNA-seq to investigate the SYK-regulated EGF-induced transcriptome. Results: Intense immunoreactivity of active pSYK(Y525/526) correlated with poor overall survival in two independent ovarian cancer cohorts. SYK directly phosphorylated EGFR and ERBB2, while knockout of SYK reduces their phosphorylation. Phosphorylation levels of SYK(Y525/526) positively correlated with EGFR(Y1187) and STAT3(Y705). Active SYK reduced sensitivity to the EGFR/ERBB2 inhibitor, lapatinib, and SYK non-phosphorylatable EGFR mutant was more sensitive to paclitaxel. SYK modulated the EGF-induced transcriptome, supporting its involvement in EGFR/ERBB2-regulated transcriptional activity. Conclusions: Our findings suggest an upstream role of SYK in regulating the EGFR/ERBB2 signaling, and provide a biological rationale for targeting SYK in ovarian cancer therapy.
2020-11-08 | GSE106716 | GEO
Project description:Neuroblastoma (NB) is considered an immunologically cold tumor and is usually less responsive to immune checkpoint blockade (ICB). Tumor-associated macrophages (TAMs) are highly infiltrated in NB tumors and promote immune escape and resistance to ICB. Hence therapeutic strategies targeting immunosuppressive TAMs can improve responses to ICB in NB. We recently discovered that spleen tyrosine kinase (Syk) reprograms TAMs toward an immunostimulatory phenotype and enhances T-cell responses in the lung adenocarcinoma model. Here we investigated if Syk is an immune-oncology target in NB and tested whether a novel immunotherapeutic approach utilizing Syk inhibitor together with radiation and ICB could provide a durable antitumor immune response in an MYCN amplified murine model of NB. Myeloid Syk KO mice and syngeneic MYCN-amplified cell lines were used to elucidate the effect of myeloid Syk on the NB tumor microenvironment (TME). In addition, the effect of Syk inhibitor, R788, on anti-tumor immunity alone or combination with anti-PDL1 mAb and radiation was also determined in murine NB models. The underlying mechanism of action of this novel therapeutic combination was also investigated. Herein, we report that Syk is a marker of NB -associated macrophages and plays a crucial role in promoting immunosuppression in the NB TME. We found that the blockade of Syk in NB-bearing mice markedly impairs tumor growth. This effect is facilitated by macrophages that become immunogenic in the absence of Syk, skewing the suppressive TME towards immunostimulation and activating anti-tumor immune responses. Moreover, combining FDA-approved Syk inhibitor, R788 (fostamatinib) along with anti-PDL1 mAb provides a synergistic effect leading to complete tumor regression and durable anti-tumor immunity in mice bearing small tumors (50 mm3) but not larger tumors (250 mm3). However, combining radiation to R788 and anti-PDL1 mAb prolongs the survival of mice bearing large NB9464 tumors.
2023-06-02 | GSE224024 | GEO
Project description:Neuroblastoma (NB) is considered an immunologically cold tumor and is usually less responsive to immune checkpoint blockade (ICB). Tumor-associated macrophages (TAMs) are highly infiltrated in NB tumors and promote immune escape and resistance to ICB. Hence therapeutic strategies targeting immunosuppressive TAMs can improve responses to ICB in NB. We recently discovered that spleen tyrosine kinase (Syk) reprograms TAMs toward an immunostimulatory phenotype and enhances T-cell responses in the lung adenocarcinoma model. Here we investigated if Syk is an immune-oncology target in NB and tested whether a novel immunotherapeutic approach utilizing Syk inhibitor together with radiation and ICB could provide a durable antitumor immune response in an MYCN amplified murine model of NB. Myeloid Syk KO mice and syngeneic MYCN-amplified cell lines were used to elucidate the effect of myeloid Syk on the NB tumor microenvironment (TME). In addition, the effect of Syk inhibitor, R788, on anti-tumor immunity alone or combination with anti-PDL1 mAb and radiation was also determined in murine NB models. The underlying mechanism of action of this novel therapeutic combination was also investigated. Herein, we report that Syk is a marker of NB -associated macrophages and plays a crucial role in promoting immunosuppression in the NB TME. We found that the blockade of Syk in NB-bearing mice markedly impairs tumor growth. This effect is facilitated by macrophages that become immunogenic in the absence of Syk, skewing the suppressive TME towards immunostimulation and activating anti-tumor immune responses. Moreover, combining FDA-approved Syk inhibitor, R788 (fostamatinib) along with anti-PDL1 mAb provides a synergistic effect leading to complete tumor regression and durable anti-tumor immunity in mice bearing small tumors (50 mm3) but not larger tumors (250 mm3). However, combining radiation to R788 and anti-PDL1 mAb prolongs the survival of mice bearing large NB9464 tumors.
2023-06-02 | GSE224020 | GEO
Project description:Macrophages (MΘs) play a critical role in tumor growth, immunosuppression and inhibition of adaptive immune responses in cancer. Hence, targeting signaling pathways in MΘs that promote tumor immunosuppression will provide therapeutic benefit. PI3Kγ has been recently established by our group and others as a novel immuno-oncology target. Herein, we report that macrophage Syk drives polarization of immunosuppressive macrophages which establish an immunosuppressive tumor microenvironment in in vivo syngeneic tumor models. Genetic or pharmacological blockade of Syk in MΘs promotes a pro-inflammatory MΘ phenotype, restores CD8+ T cell activity, destabilizes HIF under hypoxia, and stimulates antitumor immune response. Moreover, we have developed in silico the “first in class” dual Syk/PI3K inhibitor, SRX3207, for the combinatorial inhibition of Syk and PI3K in one small molecule to activate anti-tumor immunity in vivo. This chemotype shows great efficacy in various tumor models and represents a new therapeutic approach to treat devastating cancers. Significance: Our data indicate a central role of Syk in macrophage transcriptional programming leading to inhibition of adaptive immune responses. Furthermore, SRX3207 blocks macrophage expression of immunosuppressive factors and activates anti-tumor immune responses, validating the concept of combined Syk and PI3K inhibition as an effective approach to treat macrophage driven cancers.
2020-09-01 | GSE115109 | GEO
Project description:The PI3K-AKT pathway is known to regulate cytokines in dust mite-induced pediatric asthma. However, the underlying molecular steps involved are not clear. In order to clarify further the molecular steps, this study investigated the expression of certain genes and the involvement of miRNAs in the PI3K-AKT pathway, which might affect the resultant cytokine-secretion. In-vivo and in-vitro ELISA, qRT-PCR, western-blot and microarrays analyses were used in this study. A down-expression of miRNA-27b-3p in dust mite induced asthma group (group D) was found by microarray analysis. This was confirmed by qRT-PCR that found the miRNA-27b-3p transcripts that regulated the expression of SYK and EGFR were also significantly decreased (p < 0.01) in group D. The transcript levels of the SYK and PI3K genes were higher, while those of EGFR were lower in the former group. Meanwhile, we found significant differences in plasma concentrations of some cytokines between the dust mite-induced asthma subjects and the healthy controls. On the other hand, this correlated with the finding that the transcripts of SYK and its downstream PI3K were decreased in HBE transfected with miRNA-27b-3p, but were increased in HBE transfected with the inhibitor in vitro. Our results indicate that the differential expression of the miRNAs in dust mite-induced pediatric asthma may regulate their target gene SYK and may have an impact on the PI3K-AKT pathway associated with the production of cytokines. These findings should add new insight into the pathogenesis of pediatric asthma.
2018-09-20 | GSE120172 | GEO