Creb overexpression induces leukemia in zebrafish by blocking myeloid differentiation process
Ontology highlight
ABSTRACT:
ORGANISM(S): Danio rerio
PROVIDER: GSE71270 | GEO | 2016/12/06
SECONDARY ACCESSION(S): PRJNA290733
REPOSITORIES: GEO
Similar Datasets
Project description:The cAMP responsive element binding protein (CREB) pathway has been involved in two major cascades of gene expression regulating neuronal function. The first one presents CREB as a critical component of the molecular switch that control longlasting forms of neuronal plasticity and learning. The second one relates CREB to neuronal survival and protection. To investigate the role of CREB-dependent gene expression in neuronal plasticity and survival in vivo, we generated bitransgenic mice expressing A-CREB, an artificial peptide with strong and broad inhibitory effect on the CREB family, in forebrain neurons in a regulatable manner. The expression of ACREB in hippocampal neurons impaired L-LTP, reduced intrinsic excitability and the susceptibility to induced seizures, and altered both basal and activity-driven gene expression. In the long-term, the chronic inhibition of CREB function caused severe loss of neurons in the CA1 subfield as well as in other brain regions. Our experiments confirmed previous findings in CREB deficient mutants and revealed new aspects of CREB-dependent gene expression in the hippocampus supporting a dual role for CREB-dependent gene expression regulating intrinsic and synaptic plasticity and promoting neuronal survival. manufacturer's protocol. Experiment Overall Design: Each sample contained total RNA from the hippocampi of a group of 3-4 three weeks old mice. We obtained duplicate samples for each experimental condition (in total 14 WT and 20 A-CREB mice where used in this experiment). Mouse Genome 430 2.0 genechips were hybridized, stained, washed and screened for quality according to the manufacturer's protocol.
2009-01-17 | E-GEOD-14320 | biostudies-arrayexpress
Project description:Hepatocarcinoma is the third leading cause of death in cancer in the world. In recent years, research on CREB in hepatocellular carcinoma has become a hotspot, so our research group wants to use the mass spectrometry analysis what proteins can bind with CREB, and then explore the links between CREB and hepatocellular carcinoma.
2019-11-08 | PXD008261 | Pride
Project description:The cAMP responsive element binding protein (CREB) pathway has been involved in two major cascades of gene expression regulating neuronal function. The first one presents CREB as a critical component of the molecular switch that control longlasting forms of neuronal plasticity and learning. The second one relates CREB to neuronal survival and protection. To investigate the role of CREB-dependent gene expression in neuronal plasticity and survival in vivo, we generated bitransgenic mice expressing A-CREB, an artificial peptide with strong and broad inhibitory effect on the CREB family, in forebrain neurons in a regulatable manner. The expression of ACREB in hippocampal neurons impaired L-LTP, reduced intrinsic excitability and the susceptibility to induced seizures, and altered both basal and activity-driven gene expression. In the long-term, the chronic inhibition of CREB function caused severe loss of neurons in the CA1 subfield as well as in other brain regions. Our experiments confirmed previous findings in CREB deficient mutants and revealed new aspects of CREB-dependent gene expression in the hippocampus supporting a dual role for CREB-dependent gene expression regulating intrinsic and synaptic plasticity and promoting neuronal survival. manufacturer's protocol.
2009-01-12 | GSE14320 | GEO
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle. Experiment Overall Design: Cell lines. The following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 (RPMI + 10%FCS + rhGM-CSF. Cells were cultured at 37oC, 5% CO2 and split every 3 to 4 days. Primary AML bone marrow samples were processed as previously described [12]. All human samples were obtained with approval from the Institutional Review Board and consents were signed, according to the Helsinki protocol. Experiment Overall Design: shRNA sequence design and constructs. The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. [25-27]; CREB shRNA-1, CREB shRNA-2, CREB shRNA-3. Controls included empty vector, luciferase shRNA, and scrambled shRNA. shRNA sequences are: CREB shRNA-1(5âGCAAATGACAGTTCAAGCCC3â), shRNA-2 (5âGTACAGCTGGCTAACAATGG3â), shRNA-3 (5âGAGAGAGGTCCGTCTAATG3â), Luciferase shRNA (5âGCCATTCTATCCTCTAGAGGA3â), Scramble shRNA (5âGGACGAACCTGCTGAGATAT3â). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [28]. The second generation SIN vector HIV-CSCG was used to produce human shRNA vectors [29]. Experiment Overall Design: Microarray analysis. Total RNA (10 μg) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix GeneChip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. These are first quantile normalized, and then a t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab (Mathworks, Inc.). A normal quantile plot of T is shown in figure qqplot.tiff. Data points with t-scores < 1/(2N) display with red circles, were N is the total number of genes. We therefore see that there are a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.
2008-10-25 | E-GEOD-12056 | biostudies-arrayexpress
Project description:HIV-associated neurocognitive disorders (HAND) remain an unsolved problem that persists despite using antiretroviral therapy. We have obtained data showing that HIV-gp120 protein contributes to neurodegeneration through metabolic reprogramming. This led to decreased ATP levels, lower mitochondrial DNA copy numbers, and loss of mitochondria cristae, all-important for mitochondrial biogenesis. gp120 protein also disrupted mitochondrial movement and synaptic plasticity. Searching for the mechanisms involved, we found that gp120 alters the cyclic AMP response element-binding protein (CREB) phosphorylation on serine residue 133 necessary for its function as a transcription factor. Since CREB regulates the promoters of PGC1 and BDNF genes, we found that CREB dephosphorylation causes PGC1 and BDNF loss of functions. Our data was validated in vitro and in vivo. The negative effect of gp120 was alleviated in cells and animals in the presence of rolipram that inhibits the phosphodiesterase protein 4 (PDE4) and restores CREB phosphorylation. We concluded that HIV-gp120 protein contributes to HAND via inhibition of CREB protein function.
2022-06-09 | PXD031891 | Pride
Project description:The cAMP-response element binding protein H (CREB-H) is a transcription factor expressed in liver and intestinal tissues. It is well known for regulating many lipid and glucose metabolism genes. Our group aimed to screen for additional or potential genes that may be downstream of CREB-H transcription. To prevent inaccuracy arisen from endogenous CREB-H expression, we used CREB-H-knockout (CREB-H KO) mice for this study.
2024-10-26 | GSE246514 | GEO
Project description:Regulation of gene expression is essential for normal development and cellular growth. Transcriptional events are tightly controlled both spatially and temporally by specific DNA-protein interactions. In this study we finely map the genome-wide targets of the CREB protein across all known and predicted human promoters, and characterize the functional consequences of a subset of these binding events using high-throughput reporter assays. To measure CREB binding, we used HaloCHIP, an antibody-free alternative to the ChIP method that utilizes the HaloTag fusion protein, and also high-throughput promoter-luciferase reporter assays, which provide rapid and quantitative screening of promoters for transcriptional activation or repression in living cells. CREB ChIP-chip two biologcal replicates. HaloCHIP-chip three biological replicates with and without Forskolin
2010-05-22 | E-GEOD-18347 | biostudies-arrayexpress
Project description:The aim is to identify transcripts which are differentially regulated upon the duxycline-controlled induction of a transcription factor, CREB-H.<br>A cell line was developed 293.CREB-H which contains this factor under th etight control of a doxycline rwgukated activator suhc that after doxycline treatment, CREB-H is induced, and then this factor will act upon cellular target genes. These will be identiifed by comparing the profile in th esame cells before and after doxycline treatment<br>
2010-12-09 | E-MEXP-3004 | biostudies-arrayexpress
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle.
2008-08-30 | GSE12056 | GEO
Project description:The CREB family of transcription factors stimulates cellular gene expression following phosphorylation at a conserved serine (Ser133 in CREB1) in response to cAMP and other extracellular signals. In order to characterize CREB target genes in various tissues, we give a cAMP agonist, forskolin (FSK), to cell lines or primary cultures and monitor the gene expression. To eliminate CREB-independent effects of FSK on cellular gene expression, we employed a dominant negative form of CREB called A-CREB, which dimerizes selectively with and blocks the DNA binding activity of CREB but not other bZIP family members. Therefore, genes that are induced by cAMP and the induction was blocked by A-CREB treatment likely represents CREB target genes. Notes: 1) In HEK293T cells, besides the Control+FSK+(FSK-ACREB) experiments, a different set of experiments showing FSK effect on 1hr and 4hr is included. The two sets of data in HEK293T were generated at different times with different batch of cells, and comparison should be limited within each set. The cAMP induced genes at 1hr, however, was similar between the two sets. 2) These is no ACREB data for pancreatic islets or hepatocytes. For hepatocytes, however, we have included fasting liver and refed liver in additional to FSK treated primary hepatocytes. During fasting, glucagon induces cAMP increase in the liver and CREB is activated. Therefore, a more reliable list of CREB target genes in hepatocytes can be obtained by selecting those genes are that induced both during fasting and in FSK treated primary culture. Keywords: parallel sample
2005-03-02 | GSE2060 | GEO