Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Comparison of the prostate cancer cell line LNCaP and its androgen insensitive derivative C4-2B

ABSTRACT: LNCaP and its androgen insensitive derivative were profiled in order to identify genes differentially expressed during the conversion to androgen insensitivity. This experiment was performed due to the presence of an ins(7;14) localizing the entire ETV1 locus to chr 14 in LNCaP and C4-2B prostate cancer cells. Keywords: cell type comparison

ORGANISM(S): Homo sapiens

PROVIDER: GSE7702 | GEO | 2007/08/07

SECONDARY ACCESSION(S): PRJNA99471

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Comparison of the prostate cancer cell line LNCaP and its androgen insensitive derivative C4-2B

Project description:LNCaP and its androgen insensitive derivative were profiled in order to identify genes differentially expressed during the conversion to androgen insensitivity. This experiment was performed due to the presence of an ins(7;14) localizing the entire ETV1 locus to chr 14 in LNCaP and C4-2B prostate cancer cells. Keywords: cell type comparison LNCaP and C4-2B were both hybridized to Agilent Whole Human Genome Oligonucleotide Microarrays, with a commercially obtained pool of benign prostate RNA serving as the reference for both cell lines. Dye flips for both cell lines were also performed

2007-08-07 | E-GEOD-7702 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

2013-05-10 | GSE46329 | GEO

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy. Genomic targets of ERG and ETV1 transcription factors were identified by antibody-mediated and biotin-mediated ChIP-chip in human VCaP and LNCaP cells, respectively.

2013-03-01 | E-GEOD-39357 | biostudies-arrayexpress

Transcriptome profiling of prostate cancer cells on GLYATL1 knockdown

Project description:The protein Glycine-N-Acyltransferase Like 1 (GLYATL1) is involved in detoxification of benzoate and other xenobiotics and is expressed in liver and kidney. Through In silico analysis of cancer gene expression profiling and transcriptome sequencing we revealed an overexpression of GLYATL1 in primary prostate cancer. Confirming these findings by immunohistochemistry we show that GLYATL1 is overexpressed in primary prostate cancer compared to metastatic prostate cancer and benign prostatic tissue. Low grade cancers had higher GLYATL1 expression compared to high grade prostate tumors. Our studies showed that GLYATL1 is upregulated upon androgen treatment in LNCaP prostate cancer cells which harbors ETV1 gene rearrangement. Furthermore, ETV1 knockdown in LNCaP cells showed downregulation of GLYATL1 suggesting potential regulation of GLYATL1 by ETS transcription factor ETV1. Transcriptome sequencing using the GLYATL1 knockdown prostate cancer cell lines LNCaP showed regulation of multiple metabolic pathways. In summary, our study characterizes the expression GLYATL1 in prostate cancer and explore its regulation mechanism. Future studies are needed to decipher the biological significance of these findings.

2019-12-17 | GSE130395 | GEO

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

2013-03-01 | GSE39354 | GEO

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.

2013-06-13 | GSE47120 | GEO

Proteomic analysis of castrate resistant prostate cancer cell lines

Project description:In this study the development of androgen independence in a cell model of disease was selected as a mirror of to the events at play in the development of Castrate Resistant Prostate Cancer in-vivo. LNCaP cells which are androgen dependent and androgen independent sublines; LNCaP-Abl and LNCaP-Abl-Hof were subject to extensive fractionation by 1-D SDS PAGE and accurate mass-high resolution mass spectrometry (Q Exactive) to identify proteins whose expression was changes significantly in response to androgen independent growth.

2022-02-28 | PXD000751 | Pride

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions. VCAP and LNCaP cells, 24 hr after ERG or ETV1 RNA interference, respectively, were grown in hormone-depleted conditions for 2 days, and then in the presence of EtOH (vehicle) or 10nM DHT for 16hr. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39354 | biostudies-arrayexpress

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

2013-06-13 | E-GEOD-47120 | biostudies-arrayexpress