Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression profile of LNCaP prostate cancer cells with exogenous HNF4G expression

ABSTRACT: To determine genes regulated by HNF4G, we retrovirally infected LNCaP cells in triplicates to express HNF4G and empty vector as control. cDNA for HNF4G in pDONR201 vector was obtained from Harvard medical school Plasmid database (ID:HsCD00022314) and was cloned into an murine stem cell virus (MSCV)-based retroviral vector with puromycin selection marker (Addgene) using Gateway technology.

ORGANISM(S): Homo sapiens

PROVIDER: GSE85244 | GEO | 2017/11/01

SECONDARY ACCESSION(S): PRJNA337939

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

ETV4 mediates dosage-dependent prostate tumor initiation and cooperates with p53 loss to generate prostate cancer.

Project description:Comparision of transcriptome of PC3 and 22Rv1 prostate cell lines after 1 week overexpression of mutated ETV4: ETV4AAA-IRES-eGFP, wild type ETV4: ETV4WT-IRES-eGFP, and control vector IRES-eGFP by MSCV-IRES-GFP vector ((Addgene #20672)) and Lentivirus transduction.

2022-10-16 | GSE215437 | GEO

PBX3 cooperates with MEISI in causing rapid acute myeloid leukemia and recapitulates the core transcriptome of MLL-rearranged leukemia

Project description:To investigate whether co-expression of PBX3/MEIS1 can mimic that of MLL-AF9, HOXA9/MEIS1 or HOXA9/PBX3 in inducing leukemogenesis, we conducted in vivo mouse bone marrow transplantation (BMT) assays. Briefly, normal mouse bone marrow (BM) progenitor (i.e., lineage negative; Lin-) cells collected from B6.SJL (CD45.1) donor mice (CD45.1) were retrovirally co-transduced with MSCVneo-MLL-AF9+MSCV-PIG (MLL-AF9), MSCVneo-HOXA9+MSCV-PIG (HOXA9), MSCVneo-HOXA9+MSCV-PIG-MEIS1 (HOXA9+MEIS1), MSCVneo-HOXA9+MSCV-PIG-PBX3 (HOXA9+PBX3), MSCV-PIG-PBX3+MSCVneo-MEIS1 (PBX3+MEIS1), MSCVneo+MSCV-PIG-PBX3 (PBX3) , MSCVneo+MSCV-PIG-MEIS1 (MEIS1), or MSCVneo+MSCV-PIG (normal control; NC). Retrovirally transduced cells then were cultured with cytokines as well as puromycin and G418. Seven days later, the donor cells were transplanted into lethally irradiated (960 rads) 8- to 10-week-old C57BL/6 (CD45.2) recipient mice. The transplanted mice were watched for leukemogenesis. Then, gene expression profiling was conducted with bone marrow samples collected from leukemia groups and control group.

2016-03-03 | GSE68643 | GEO

HNF4G, AR, FOXA1, H3K4me1, H3K27acetyl binding sites upon knockdown and overexpression of HNF4G in 22Rv1 and LNCaP prostate cancer cells respectively

Project description:HNF4G is a gastrointestinal tissue enriched master transcriptional regulator seen overexpressed in a subset of prostate cancer. Here we have mapped binding sites of HNF4G, AR, Foxa1, H3K4me1, H3K27acetyl upon knockdown and overexpression of HNF4G in in 22Rv1 and LNCaP cells respectively

2017-11-01 | GSE85558 | GEO

Both gain and loss of function of miR-126 promote t(8;21) leukemia progression with different consequences and through different mechanisms

Project description:To investigate the pathological effect of miR-126 on the progression of acute myeloid leukemia (AML) induced by AML1-ETO9a (AE9a), we conducted a series of mouse bone marrow transplantation (BMT) assays with the following groups: AE9a (primary donor cells were wild-type mouse bone marrow progenitor (i.e., lineage negative; Lin-) cells retrovirally transduced with MSCV-PIG-AE9a), AE9a+miR-126 (primary donor cells were wild-type mouse bone marrow progenitor (i.e., Lin-) cells retrovirally transduced with MSCV-PIG-AE9a-miR-126), and miR-126KO+AE9a (primary donor cells were miR-126 knockout mouse bone marrow progenitor (i.e., Lin-) cells retrovirally transduced with MSCV-PIG-AE9a), along with a control group (primary donor cells were wild-type mouse bone marrow progenitor (i.e., Lin-) cells retrovirally transduced with MSCV-PIG empty vector). The control group was only used in the primary and secondary BMT assays, whereas the three leukemic groups including AE9a, AE9a+miR-126 and miR-126KO+AE9a were used in four passages (i.e., primary, secondary, tertiary and quaternary) of BMT assays. Then, gene expression profiling was conducted with bone marrow samples collected from different groups to decipher the molecular mechanisms underlying miR-126 effects on leukemia initiation and progression and maintenance and self-renewal of leukemia stem/initiating cells.

2015-09-07 | GSE65939 | GEO

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

Expression profile of HNF1A knockdown and overexpression in 22RV1 and LNCaP cells respectively

Project description:To determine genes regulated by HNF1A in 22Rv1, we performed siRNA mediated knockdown of HNF1A using pooled siHNF1A (L-008215-00-0005 5 nmol) and pooled siSCR purchased from Dharmacon. RNA was harvested 3 days after transfection and gene expression profiling was performed. Similarly to determine genes regulated by HNF1A in LNCaP, we performed retroviral transduction of LNCaP cells in duplicate for HNF1A and empty vector control expression. cDNA for HNF1A in RC211201 vector (origene) was subcloned into a murine stem cell virus (MSCV)-based retroviral vector with hygromycin selection marker (Addgene). After 3 days of transduction, cells were selected for four days in hygromycin and later on RNA was harvested for gene expression profiling.

2017-11-01 | GSE85556 | GEO

Effect of hyper-and hypoactivation of Notch signaling in IL-4-stimulate THP-1

Project description:MSCV-GFP-IRES (IRES), MSCV-GFP-Myc-NIC1 (NIC1) and MSCV-GFP-DNMAML (DNMAML) were retrovirally transduced in to THP-1 cell (pCL-Ampho was used as packaging plasmid). GFP positive cells were sorted for selective desired cell. Then IRES, NIC1 and DNMAML overexpressing THP-1 were pretreated with PMA (5ng/ml) for 48 h before stimulation with IL-4 (20 ng/ml) for 3 h.

2019-05-01 | GSE115914 | GEO

Expression profile of LNCaP/AR cells with or without HNF4G expression grown for long term in charcoal stripped-serum (CSS) media

Project description:To study the underlying mechanism of androgen independent growth we performed transcriptome analysis of LNCaP/AR-Vec and LNCaP/AR-HNF4G at day 9 of growth in CSS and LNCaP/AR-HNF4G at 32 days of growth in CSS to identify the HNF4G transcriptome, as well as determinants of castration-resistant growth

2017-11-01 | GSE85557 | GEO

Transgenic yeast (pAG305GPD-AAE13) vs. control yeast (pAG305GPD-ccdB)

Project description:The yeast expression vectors used to express AAE13 was constructed as follows: AAE13 (At3g16170) was amplified from the vector pENTR-AAE13. The amplified product was cloned into pCR®8⁄GW⁄TOPO® (Invitrogen). The resulting plasmid was combined with the Advanced Gateway destination vectors pAG305GPD-ccdB (Addgene, Boston, MA) in an attL X attR recombination reaction to generate the vectors pAG305GPD-AAE13. The integrating vector pAG305GPD-AAE13 was introduced into WAT11, which was also transformed empty vector pAG305GPD-ccdB as control (B1, B2, B3 and B4). The transgenic and control yeast cells were cultured in SD-drop out medium at 30 °C under shaken conditions, malonate was fed into cells at final concentration 0.2 mM when the value of OD600 reached at 0.1. The cells were harvested at mid-log phase.

2013-11-26 | GSE52701 | GEO

Transgenic yeast (pAG305GPD-AAE13) vs. control yeast (pAG305GPD-ccdB)

Project description:The yeast expression vectors used to express AAE13 was constructed as follows: AAE13 (At3g16170) was amplified from the vector pENTR-AAE13. The amplified product was cloned into pCRM-BM-.8M-bM-^AM-^DGWM-bM-^AM-^DTOPOM-BM-. (Invitrogen). The resulting plasmid was combined with the Advanced Gateway destination vectors pAG305GPD-ccdB (Addgene, Boston, MA) in an attL X attR recombination reaction to generate the vectors pAG305GPD-AAE13. The integrating vector pAG305GPD-AAE13 was introduced into WAT11, which was also transformed empty vector pAG305GPD-ccdB as control (B1, B2, B3 and B4). The transgenic and control yeast cells were cultured in SD-drop out medium at 30 M-BM-0C under shaken conditions, malonate was fed into cells at final concentration 0.2 mM when the value of OD600 reached at 0.1. The cells were harvested at mid-log phase. Two-condition experiment, Transgenic yeast (pAG305GPD-AAE13) vs. control yeast (pAG305GPD-ccdB). Biological replicates: 4 control replicates, 4 transgenic replicates.

2013-11-26 | E-GEOD-52701 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data