Project description:To study the consequence of HNF4G target genes expression with ABBV-075 treatment in cells that have BETi-independent HNF4G expression, we performed RNA-Seq on 22Rv1 cells that exogenously express HNF4G using GFP expression as control.
Project description:HNF4G is a gastrointestinal tissue enriched master transcriptional regulator seen overexpressed in a subset of prostate cancer. Here we have mapped binding sites of HNF4G, AR, Foxa1, H3K4me1, H3K27acetyl upon knockdown and overexpression of HNF4G in in 22Rv1 and LNCaP cells respectively
Project description:To determine genes regulated by HNF4G, we retrovirally infected LNCaP cells in triplicates to express HNF4G and empty vector as control. cDNA for HNF4G in pDONR201 vector was obtained from Harvard medical school Plasmid database (ID:HsCD00022314) and was cloned into an murine stem cell virus (MSCV)-based retroviral vector with puromycin selection marker (Addgene) using Gateway technology.
Project description:Purpose: Even in last stage of metastatic castration-resistant prostate cancer, androgen receptor (AR) signaling remains active.To derive high metastatic prostate cancer (PCa), we labeled AR-positive but castration-resistant 22Rv1 PCa cells with luciferase gene (22Rv1-Luc2) and these cells were orthotopically implanted in mouse prostate for spontaneous progression. Methods: 2 × 10^5 of luciferase-expressing 22Rv1 cells (22Rv1-Luc2) cells were implanted in the anterior prostate of nude mice. After 12-14 weeks, the host mice were necropsied and the metastases from lumbar lymph nodes and primary tumors were dissected under laminar flow. Tumor tissues were minced using sterile scalpels and further digested with Collagenase D for 1 h. The lymph node metastatic cancer cells, named 22Rv1-M1, were orthotopically reimplanted in nude mice. At 12 weeks, the secondary metastases were isolated in the lumbar lymph nodes and designated as 22Rv1-M2 cells. Suspension of 1 × 10^6 22Rv1-M2 cells in DPBS was injected into nude mice through the tail vein, and mice developed metastases (22Rv1-M3) after 6 week. This procedure was repeated once to attain the 22Rv1-M4. Results: 22Rv1-derived metastatic cell lines exhibit increased in vitro and in vivo invasion activity as the progression from 22Rv1 to M4. Transcriptomic analysis of genome-wide gene expression in the M4 tumors reveal the unique gene expression profile compared to 22Rv1 tumors. Conclusions: Transcriptomic data provide the gene network for decoding the mechanism of PCa metastasis.
Project description:To study the underlying mechanism of androgen independent growth we performed transcriptome analysis of LNCaP/AR-Vec and LNCaP/AR-HNF4G at day 9 of growth in CSS and LNCaP/AR-HNF4G at 32 days of growth in CSS to identify the HNF4G transcriptome, as well as determinants of castration-resistant growth
Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.
