Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Design, characterization, and use of a novel amyloid β-protein control for assembly, neurotoxicity, and gene expression studies

ABSTRACT: A key pathogenic agent in Alzheimer’s disease (AD) is the amyloid β-protein (Aβ), which self-assembles into a variety of neurotoxic structures. Establishing structure-activity relationships for these assemblies is critical for proper therapeutic target identification and design. We examined the effects of Aβ monomers, dimers, higher-order oligomers, and fibrils on gene expression in primary rat hippocampal neurons. As opposed to “reverse” Aβ or non-Aβ peptides typically used as controls in such studies, we designed novel scrambled Aβ peptides predicted to behave distinctly from native Aβ. Significant changes in gene expression were observed for all peptide assemblies, but fibrils induced the largest changes. Significant changes in gene expression were observed for all peptide assemblies, but fibrils induced the largest changes. Weighted gene co-expression network analysis (WGCNA) revealed two predominant gene modules related to Aβ treatment. Many genes within these modules were associated with inflammatory signaling pathways

ORGANISM(S): Rattus norvegicus

PROVIDER: GSE85952 | GEO | 2016/08/24

SECONDARY ACCESSION(S): PRJNA339827

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Design, characterization, and use of a novel amyloid Î²-protein control for assembly, neurotoxicity, and gene expression studies

Project description:A key pathogenic agent in Alzheimerâs disease (AD) is the amyloid Î²-protein (AÎ²), which self-assembles into a variety of neurotoxic structures. Establishing structure-activity relationships for these assemblies is critical for proper therapeutic target identification and design. We examined the effects of AÎ² monomers, dimers, higher-order oligomers, and fibrils on gene expression in primary rat hippocampal neurons. As opposed to âreverseâ AÎ² or non-AÎ² peptides typically used as controls in such studies, we designed novel scrambled AÎ² peptides predicted to behave distinctly from native AÎ². Significant changes in gene expression were observed for all peptide assemblies, but fibrils induced the largest changes. Significant changes in gene expression were observed for all peptide assemblies, but fibrils induced the largest changes. Weighted gene co-expression network analysis (WGCNA) revealed two predominant gene modules related to AÎ² treatment. Many genes within these modules were associated with inflammatory signaling pathways We examined the effects of AÎ² monomers, dimers, higher-order oligomers, and fibrils on gene expression in primary rat hippocampal neurons. Novel scrambled AÎ² peptides, as opposed to âreverseâ AÎ² or non-AÎ² peptides, were used as controls. Please note that the 'XL42_1' sample was excluded from data processing as an outlier (resulting total 23 sample records). However the 'XL42_1' raw data is provided in the 'non_normalized.txt' (total 24 data columns).

2016-08-24 | E-GEOD-85952 | biostudies-arrayexpress

Transcriptome sequencing of hippocampal tissue of APP/PS1 mice treated with rotating magnetic field for 12 months

Project description:Amyloid beta (Aβ) monomers aggregate to form fibrils and amyloid plaques, which is one of the important mechanisms in the pathogenesis of Alzheimer's disease (AD). Since the Aβ1-42 aggregation has prominent role in plaque formation, which eventually lead to the patient's brain lesions and cognitive impairment, an increasing number of studies have been devoted to reduce Aβ aggregation process to slow down AD progression. Since the diphenylalanine (FF) sequence is critical for amyloid aggregation, and it has been shown that magnetic fields can affect the alignment of peptide assembly due to the diamagnetic anisotropy of aromatic rings, here we used a moderate-intensity rotating magnetic field (RMF) to explore its effect on Aβ aggregation and AD pathogenesis. Our data showed that RMF can directly inhibit Aβ amyloid fibril formation and reduce Aβ-induced cytotoxicity on neural cells in vitro. Using the AD mouse model APP/PS1, we found that the RMF can restore their motor ability to the healthy control level. Their cognitive impairments, including exploration ability, spatial and non-spatial memory abilities, were also significantly alleviated. Tissue examinations reveal that RMF has reduced amyloid plaque accumulation, attenuated microglial activation ,and reduced oxidative stress in the APP/PS1 mouse brain. Therefore, our data demonstrate the great potential of RMF to be developed as a non-invasive, high-penetration physical approach to be applied in the treatment of AD.

2024-06-06 | GSE269222 | GEO

Microglial response to Aβ and prostaglandin-E2 EP4 receptor activation

Project description:A persistent and non-resolving inflammatory response to accumulating Aβ peptide species is a cardinal feature in the development of Alzheimer's disease (AD). In response to accumulating Aβ peptide species, microglia, the innate immune cells of the brain, generate a toxic inflammatory response that accelerates synaptic and neuronal injury. Many pro-inflammatory signaling pathways are linked to progression of neurodegeneration. However, endogenous anti-inflammatory pathways capable of suppressing Aβ-induced inflammation represent a relatively unexplored area. Here we hypothesized that signaling through the prostaglandin-E2 (PGE2) EP4 receptor potently suppresses microglial inflammatory responses to Aβ42 peptides. In cultured microglial cells, EP4 stimulation attenuated levels of Aβ42-induced inflammatory factors and potentiated phagocytosis of Aβ42. Microarray analysis was performed and demonstrated that EP4 stimulation broadly opposed Aβ42-driven gene expression changes in microglia, with enrichment for targets of IRF1, IRF7, and NF-κB transcription factors.

2014-04-25 | GSE55627 | GEO

RNAseq analysis of primary astrocyte and microglia under Aβ40WT and Aβ42WT fibrils treatment

Project description:To investigate the influence of Aβ40WT and Aβ42WT fibrils on astrocyte and microglia, we isolated astrocyte and microglia from P2 SD rats and treated glia cells with Aβ40WT and Aβ42WT fibrils for 24 hours. We then performed gene expression profiling analysis using data obtained from RNA-seq of astrocyte and microglia treated with Aβ fibrils.

2022-08-17 | GSE211198 | GEO

Expression data from C57/6J mice (Normal), APP/PS1 mice and APP/PS1 mice treatment with HPYD

Project description:Aβ is a peptide of 39-42 amino acid residues that derived from putative intramembranous processing of amyloid precursor protein (APP) at the proposed active site of the γ-secretase/PS1 aspartyl. Aβ has been shown to aggregate and accumulate abnormally in the brain of AD (Alzheimer's disease), and extracellular amyloid plaques of Aβ peptides aggregation can trigger a cascade of pathologic events leading to nerve fiber entanglement and neuronal apoptosis protease. We used microarrays to investigate the effects of HPYD on the gene expression of APP/PS1 transgenic mice, the brain tissues of control group, model group and HPYD group mice.

2018-02-23 | GSE104249 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

GM1 promotes early Aβ oligomer formation and maintenance

Project description:The aggregation of amyloid beta (Aβ) peptide is associated with Alzheimer’s disease (AD) pathogenesis. Cell membrane composition, especially monosialotetrahexosylganglioside (GM1), is known to promote the formation of Aβ fibrils, yet little is known about the roles of GM1 in the early steps of Aβ oligomer formation. Here, by using GM1-contained liposomes as a mimic of neuronal cell membrane, we demonstrate that GM1 is a critical trigger of Aβ oligomerization and aggregation. We find that GM1 not only promotes the formation of Aβ fibrils, but also facilitates the maintenance of Aβ oligomers on liposome membranes. We structurally characterize the Aβ oligomers formed on the membrane and find that GM1 captures Aβ by binding to its arginine-5 residue. To interrogate the mechanism of Aβ oligomer toxicity, we design a new liposome-based Ca2+-encapsulation assay and provide new evidence for the Aβ ion channel hypothesis. Finally, we conduct cell viability assay to determine the toxicity of Aβ oligomers formed on membranes. Overall, by uncovering the roles of GM1 in mediating early Aβ oligomer formation and maintenance, our work provides a novel direction for pharmaceutical research for AD.

2023-05-10 | PXD029117 | Pride

Glycosylated clusterin species facilitate amyloid beta toxicity in human neurons.

Project description:Clusterin (CLU) is one of the most significant genetic risk factors for late onset Alzheimer’s disease. Numerous studies have now demonstrated that CLU-AD mutations and amyloid-β (Aβ) treatment alter the trafficking and localisation of glycosylated CLU. iPSCs with altered CLU trafficking were generated following the removal of CLU exon 2 by CRISPR/Cas9 gene editing. Neurons were generated from control, unedited and exon 2 -/- iPSCs and were incubated with aggregated Aβ peptides. Changes in cell death and neurite length were quantified to determine if altered CLU protein trafficking influenced neuronal sensitivity to Aβ.

2022-07-05 | GSE207466 | GEO

Microglial Piezo1 senses Aβ fibrils stiffness to restrict Alzheimer’s disease

Project description:Microglial Piezo1 senses Aβ fibrils stiffness to restrict Alzheimer’s disease

| PRJNA818969 | ENA

Gene expression induced by LPS, two amyloidogenic peptides, Tau 623-628 and Amylin 28-33, in peritoneal macrophages and B1a cells

Project description:Amyloidogenic peptides are therapeutic in EAE, reducing systemic levels of IL6, TNF, and INFg. The fibrils are bound and endocytosed in peritoneal MFs and B1a cells. Differential gene expression was used to further understand the process.

2015-09-15 | GSE73026 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data