Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The neomycin resistance cassette in the targeted allele of Shank3B knock-out mice has potential off-target effects to produce an unusual Shank3 isoform

ABSTRACT: Variants of the SH3 and multiple ankyrin repeat domains 3 (SHANK3), which encodes postsynaptic scaffolds, are associated with brain disorders. The targeted alleles in a few Shank3 knock-out (KO) lines contain a neomycin resistance (Neo) cassette, which may perturb the normal expression of neighboring genes; however, this has not been investigated in detail. We previously reported an unexpected increase in the mRNA expression of Shank3 exons 1~12 in the brains of Shank3B KO mice generated by replacing Shank3 exons 13~16 with the Neo cassette. In this study, we confirmed that the increased Shank3 mRNA in Shank3B KO brains produced an unusual ~60 kDa Shank3 isoform (Shank3-N), which did not properly localize to the synaptic compartment.

INSTRUMENT(S): Orbitrap Fusion Lumos

ORGANISM(S): Mus Musculus (ncbitaxon:10090)

SUBMITTER: Jin Young Kim

PROVIDER: MSV000086539 | MassIVE | Mon Nov 30 23:48:00 GMT 2020

SECONDARY ACCESSION(S): PXD022828

REPOSITORIES: MassIVE

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

miRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

Project description:In order to determine the effect of neoR gene in Q175 locus, miRNASeq was performed to compare the transcriptional signatures of zQ175 knock-in neo-in (z_Q175 KI) (CHDI-81003003) and zQ175 KI neo-out (Z_Q175 (neo -) KI) (CHDI-81003019) mouse lines. The z_Q175 KI is a knock-in mouse line with humanized exon 1 (190-200 pure CAG repeats) derived from Q140 KI colony. It contains floxed neo cassette upstream of exon 1. The Z_Q175 KI (neo -) KI was generated by crossing the Z-Q175 KI line with a zp3-cre transgenic line to delete out the neo cassette.

2018-12-19 | GSE123664 | GEO

mRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

Project description:In order to determine the effect of neoR gene in Q175 locus, mRNASeq was performed to compare the transcriptional signatures of zQ175 knock-in neo-in (z_Q175 KI) (CHDI-81003003) and zQ175 KI neo-out (Z_Q175 (neo -) KI) (CHDI-81003019) mouse lines. The z_Q175 KI is a knock-in mouse line with humanized exon 1 (190-200 pure CAG repeats) derived from Q140 KI colony. It contains floxed neo cassette upstream of exon 1. The Z_Q175 KI (neo -) KI was generated by crossing the Z-Q175 KI line with a zp3-cre transgenic line to delete out the neo cassette.

2018-12-19 | GSE123657 | GEO

Transcription profiling by array of mouse wild type and Prss16 knockouts

Project description:Transcription profiling of Prss16 Tssp can be used to evidentiate further endopeptidase genes candidate to self-peptide generation in the thymus. All mice studied were C57BL/6 background and KO (knockout) Prss16-deficient mice were previously obtained by homologous recombination in embryonic stem (ES) cells of a targeting vector carrying Neo resistance gene marker, which has allowed replacement of exons 8 to 12 of the Prss16 gene in KO mice (data not shown). Briefly, one properly targeted ES clone was injected into BALB/c blastocysts to generate chimeric mice. Chimeric males were mated to C57BL/6 females to generate heterozygous pups in which the Neo selection cassette had been excised. Mice heterozygous for the mutation,originally on mixed 129/Sv x C57BL/6 genetic background, were intercrossed to generate homozygous mutants (Prss16-/-), WT (Prss16+/+) and heterozygousmutants (Prss16+/-) littermates. Genotype analysis was performed on genomic DNA from tail biopsies using PCR primers F (5M-^R GCCTGACACAAGTCGCCATAGG 3M-^R),R1 (5M-^R CCAGTTCCTCCCTCAGCACAG 3M-^R) and R2 (5M-^R CCAGTAAGAGTGAGGTCCAGAC 3M-^R). The WT Prss16 allele was visualized as a 600 bp fragment using the F-R1 pair ofprimers, whereas the mutant allele was visualized as a 447 bp fragment using the F-R2 pair of primers. Absence of mRNA expression in the thymus of Prss16-/- mice was confirmed by northern-blot using a cDNA probe (data not shown). The Prss16 deficient mice were crossed onto a C57BL/6 background for eightgenerations and the thymi of the resulting mice were used for analysis.

2010-08-31 | E-MEXP-2829 | biostudies-arrayexpress

Brain BRCA1 conditional knockout

Project description:BRCA1 nestin CRE conditional knockout cortrices of P7 animals were compared to wildtype littermates to characterize the mutant phenotype. Keywords: expression BRCA1 conditional knockouts using nestin CRE and a null allele with an inverted neo cassette at the 5' end of the exon 11 of BRCA1 on one floxed allele flanking exons 5-13. Cortices of 3 wildtype animals were compred to 3 BRCA cKO at postnatal day 7.

2011-09-07 | E-GEOD-6310 | biostudies-arrayexpress

mRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

Project description:mRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

| PRJNA509459 | ENA

miRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

Project description:miRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

| PRJNA509472 | ENA

Identification of FUS RNA targets in HeLa cells

Project description:We identified a landscape of FUS-binding RNA targets in HeLa cells. The majority of the FUS binding sites are in introns of pre-mRNAs and less are in exons and untranslated regions. Significant FUS binding in introns flanking cassette exons, long intron (>100kb) containing transcripts and noncoding RNAs were detected in our study. We specifically determined the function of FUS in regulating the alternative splicing of cassette exons. The top FUS-associated cassette exon is exon 7 of the pre-mRNA of FUS itself. We demonstrated that FUS is a repressor of its own exon 7 splicing. FUS autoregulates its own protein levels by exon 7 alternative splicing and nonsense mediated decay. Moreover, Amyotrophic Lateral Sclerosis (ALS) linked FUS mutants are deficient in FUS autoregulation.

2013-12-16 | GSE50178 | GEO

Identification of FUS RNA targets in HeLa cells

2013-12-16 | E-GEOD-50178 | biostudies-arrayexpress

mRNASeq and miRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

Project description:mRNASeq and miRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

| PRJNA509468 | ENA

Loss of Apela peptide in mice causes low penetrance embryonic lethality and defects in early mesodermal derivatives

Project description:Apela (also referred to as Elabela, Ende and Toddler) is a small signaling peptide that activates the G protein-coupled receptor Aplnr. We used CRISPR/Cas9 to generate a null, reporter-expressing allele, in order to study the role of Apela in the developing mouse embryo. We found that loss of Apela results in low penetrance cardiovascular defects that manifest after the onset of circulation. Targeted Apela null alleles exhibited different transcriptional activity depending on the presence or absence of a Neomycin selection cassette. These are referred to as Apela KO NEO-IN and Apela KO NEO-OUT strains, respectively. Despite subtle phenotypic characteristics that were unique to the NEO-OUT mutants, both Apela null strains shared the same variable expressivity of cardiovascular defects and the same penetrance of embryonic lethality. To investigate the earliest regulatory events leading to physical abnormalities in Apela mutants, we performed RNA-Seq on whole stage-matched and morphologically normal E7.5 embryos (3 wild-type, 6 Apela KO NEO-IN, and 6 Apela KO NEO-OUT individuals). We chose this stage because Apela is initially expressed in the embryo at late gastrulation, shortly after the emergence of extraembryonic mesoderm progenitors. Since modification of the Apela locus may influence the expression of neighboring genes, we examined the expression of upstream and downstream sequences and found no significant difference in their expression. Downregulated genes of interest included several mitochondrial genes, Ceacam2, Ulk4, and Mov10l1. Upregulated genes included the vascular endothelial growth factor Vegfc. Principal component analysis identified outliers (KO1 and KO9), both of which expressed lower levels of mesoderm markers. KO9 was further characterized by aberrant upregulation of erythroid and myeloid markers. This finding was confirmed in our study by qRT-PCR analysis of additional Apela null individuals.

2017-08-01 | GSE101748 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data