M-CMV infected Nicotiana tabacum
Ontology highlight
ABSTRACT:
ORGANISM(S): Tobacco Nicotiana Tabacum
TISSUE(S): Plant
DISEASE(S): Mosaic Virus Infection
SUBMITTER: 
Rong Lei
PROVIDER: ST000497 | MetabolomicsWorkbench | Sun Oct 23 00:00:00 BST 2016
REPOSITORIES: MetabolomicsWorkbench
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| mwtab | Other |
Items per page: 5 1 - 1 of 1 |
Similar Datasets
Project description:Here we performed a transcriptomic study on complete symptom development process of CMV-infected Nicotiana tabacum using Solexa/Illumina's high-throughput digital gene expression (DGE) system. 12 DGE libraries (from six virus-infected samples and six corresponding mock-inoculated samples) were constructed, and the gene expression variations between the virus-infected sample and the mock-inoculated sample in each symptom stage were compared. Thousands of differentially expressed genes were obtained by the comparison, and KEGG pathway analysis of these genes suggested that many biological processes (such as phtosynthesis, pigment metabolism and plant-pathogen interaction) were related to the symptom development. The authenticity of the DGE data was further confirmed by analyzing real-time RT-PCR using several random-selected genes. We sequenced a cDNA library constructed from mixture of total RNA from six virus-infected samples and six mock-inoculated samples to get gene information for tobacco leaves in different symptom stages, including vein clearing, mosaic, severe chlorosis, partial recovery, total recovery and re-mosaic, and 95,916 Unigenes were obtained
2012-11-09 | GSE30162 | GEO
Project description:Here we performed a transcriptomic study on complete symptom development process of CMV-infected Nicotiana tabacum using Solexa/Illumina's high-throughput digital gene expression (DGE) system. 12 DGE libraries (from six virus-infected samples and six corresponding mock-inoculated samples) were constructed, and the gene expression variations between the virus-infected sample and the mock-inoculated sample in each symptom stage were compared. Thousands of differentially expressed genes were obtained by the comparison, and KEGG pathway analysis of these genes suggested that many biological processes (such as phtosynthesis, pigment metabolism and plant-pathogen interaction) were related to the symptom development. The authenticity of the DGE data was further confirmed by analyzing real-time RT-PCR using several random-selected genes. We sequenced a cDNA library constructed from mixture of total RNA from six virus-infected samples and six mock-inoculated samples to get gene information for tobacco leaves in different symptom stages, including vein clearing, mosaic, severe chlorosis, partial recovery, total recovery and re-mosaic, and 95,916 Unigenes were obtained Tobacco leaves were inoculated by CMV-infected leaf homogenate and healthy leaf homogenate, respectivley. Six time points with different symptom stage were selected, and one virus-infect sample and one mock-inoculated sample were collected at each time. In order to average out variation of different plants, five leaves from five different plants were mixed to prepare every RNA sample. Twelve individual tag libraries of samples (six infected samples and six mock-inoculated samples) were constructed in parallel. For the gene expression analysis, the twelve samples were grouped into six groups, and each group contained a virus-infected sample and a mock-inoculated sample collected at the same time. In each group, the DGE data of virus-infected sample were compared to that of mock-inoculated sample to obtain the gene expression variations. Illumina sequencing of transcripts from virus-infected and mock-inoculated samples to get gene information for tobacco leaves in different symptom stages. In order to get more gene information, the systemically infected leaves and mock-inoculated leaves were harvested at six time points and five leaves from five different plants were collected at each time point. The RNA-Seq analysis provided gene information for mock-inoculated and virus-infected tobacco leaves in different symptom stages.
2012-11-09 | E-GEOD-30162 | biostudies-arrayexpress
Project description:White areas of star-type bicolor petals of petunia (Petunia hybrida) are caused by post-transcriptional gene silencing (PTGS) of the key enzyme of anthocyanin biosynthesis. We observed blotched flowers and vein-clearing symptom in leaves in 3- to 4-month-old petunia plants. In order to determine the cause of blotched flowers, we examined an endogenous pararetrovirus, petunia vein clearing virus (PVCV), because this virus causes vein-clearing symptom and may have a suppressor of PTGS. Transcripts and episomal DNA derived from proviral PVCV loci highly accumulated in 3- to 4-month-old plants, indicating that PVCV was activated as the host plant ages. Furthermore, CG and CHG sites of the promoter region of PVCV were highly methylated in 1-month-old plants but these cytosines were not methylated in 3- to 4-month-old plants, suggesting that poor maintenance of DNA methylation activates propagation of PVCV. In parallel, de novo methylation at CHH sites and 24-nt small RNAs were detected on the promoter region of PVCV, indicating that RNA-directed DNA methylation was induced by PVCV activation. Detections of transcripts and episomal DNA of PVCV in blotched regions and suppressor activity of PTGS support the mechanism that suppression of PTGS by activated PVCV causes blotched flowers.
2020-02-18 | GSE145373 | GEO
Project description:We report here the RNAseq data generated from a drought experiment using tomato leaves (Solanum lycopersicum), in which three timepoints and two treatments were collected. More specifically, RNAseq was generated from tomato plants prior to drought (T0), during a period of drought (T1) and after a period of recovery from drought (T2). At timepoints 1 and 2 (T1 & T2), a control set of plants that were continuously watered are also included. Furthermore, at each timepoint, each leaf was dissected into two parts, including the vein and intervein. The samples are therefore named as Tissue/Timepoint/Treatment, and include VT0W (vein, T0, watered), VT1W (vein, T1, watered), VT1D (vein, T1, drought), VT2D, VT2W and IVT0W (intervein, T0, Watered), IVT1D, IVT1W, IVT2D, IVT2W. Note that VT2D and IVT2D, while named "drought", were actually recovered from drought.
2020-10-31 | GSE156402 | GEO
Project description:Potato yellow vein virus (PYVV) was detected by RT-PCR in potatoes grown in the Central Colombian highlands, north of Bogotá (~3000 mt height). At this altitude viral whitefly vectors are largely absent, but infection persists because of the use of uncertified tubers. Plants with typical PYVV-induced yellowing symptoms, as well as with atypical yellowing or non-symptomatic were sampled at three separate geographical locations. And five of them were subjected to Next Generation Sequencing (NGS) of their small RNA (sRNA) populations. Contigs to any virus were assembled, and complete or almost complete sequences of four PYVV isolates were thus re-constructed, all from symptomatic plants. Three viral isolates infected plants singly, while the fourth one co-infected the plant together with a potyvirus (potato virus Y, PVY). Relative proportions of sRNAs to each of the three viral genomic RNAs were assessed and found to remain comparable between the four infections. Genomic regions were identified as hotspots to sRNA formation, or as regions that induced poorly sRNAs. Furthermore, PYVV titers in the mixed vs. the single infections were found to be remained comparable, indicating absence of synergistic/antagonistic effect of the potyvirus on the accumulation of PYVV.
2021-03-03 | GSE157752 | GEO
Project description:Title : Characterization of genes differentially expressed in roots of transgenic arabidopsis lines expressing the p25 protein of beet necrotic yellow vein virus.<br> <br> Biological question : <br> Rhizomania ("crazy root") is a severe disease of sugar beet caused by beet necrotic yellow vein virus (BNYVV), which is transmitted by the soil-inhabiting fungus Polymyxa betae. Symptoms of virus infection are characterized by a constricted tap root and a massive proliferation of fine rootlets that often undergo necrosis. BNYVV RNA-3 encodes a 25 kDa (p25) which is an important determinant of leaf symptom phenotype. It also governs BNYVV invasion of the plant root system and induction of rootlet proliferation in sugar beet.<br> In order to obtain a better understanding of molecular aspects of disease development in roots and to characterize specific host genes involved in response to viral infection, transgenic Arabidopsis overexpressors of p25 viral protein was obtained and better characterized. It was shown that transgenic plants that efficiently expressed p25 protein produced more lateral roots. <br> Comparative analysis (microarray) was performed between wild type Arabidopsis roots and transgenic Arabidopsis roots expressing p25 protein, in order to identify Arabidopsis genes differentially expressed in response to p25 viral protein.<br> <br> Experiment description: <br> Seeds were surface sterilized, chilled at 4C for 4 days, and then germinated and grown on square Petri plates containing sterilized Murashige and Skoog (MS) medium with 1% sucrose. Such stock plates were arranged vertically in plastic racks and placed into growth chamber. After 5 days, plants were transferred carefully onto fresh MS medium big round plates. On each plate, 60 Wild Type (WT) plantlets were transferred on the half right of the plate, and 60 transgenic plantlets (B, E or T lines) were transferred on the half left of the plate. Plates were arranged horizontally and placed into growth chamber. <br> <br>Experiment 1 : 5 plates containing WT0A control plants and B0A transgenic plants. <br> <br>Experiment 2 : 5 plates containing WT1 control plants and B transgenic plants. <br>5 plates containing WT2 control plants and E transgenic plants. <br>5 plates containing WT3 control plants and T transgenic plants. <br> <br>Plants were harvested after 7 days (experiment 1) or 12 days (experiment 2), and WT roots or transgenic roots were pooled and conserved at -80C.
2007-12-08 | E-MEXP-404 | biostudies-arrayexpress
Project description:Background: It has been observed in some plant-virus interaction under certain circumstances that the plants show a sign of healing from virus-infection, a phenomenon called symptom recovery. The nature of molecular processes behind symptom recovery has been an enigma in plant virology for a long time. Discovery of RNA silencing provided a possible mechanism to explain some aspects of recovery but not all. Results: We provide evidence that silencing is not the reason for recovery in CymRSV-infected Nicotiana benthamiana plants. Transcriptome analysis followed by in situ hybridization experiments shed light on the expressional changes in the shoot apical meristem (SAM) region upon virus infection. We observed a severe loss of meristem function in the SAM which was accompanied by the downregulation of meristem-specific genes. Among the upregulated genes we found an enrichment of salicylate-metabolism and signalling, and autophagy-related functions (among many others) suggesting that these genes might play a role in shoot necrosis and symptom recovery. Conclusion: Our data suggest that the loss of meristem function is a result of salicylate-induced programmed cell death.
2019-09-12 | GSE131476 | GEO
Project description:We performed a transcriptomic analysis of Pi-starvation and recovery after resupplying Pi in Arabidopsis thaliana (Columbia-0) wild type plants and double mutant spx1,spx2. Results show that SPX1 is a Pi-dependent inhibitor of the transcription factor PHR1, a central regulatory protein in the control of transcriptional responses to Pi starvation. The analysis was performed in wild-type and double spx1,spx2 double mutant plants grown for seven days in complete (+Pi) and Pi-lacking (-Pi) Johnson solid media. Then, plants were transferred to complete medium for 4 hours to analyze the effect of resupplying plants with Pi.
2014-09-30 | E-GEOD-52046 | biostudies-arrayexpress
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:PPP4R3A, namely SMEK1 (Suppressor of Mek1 null), encodes a regulatory subunit of protein phosphatase 4 that is highly expressed in nervous system. Experimental autoimmune encephalomyelitis (EAE) is an animal disease model of multiple sclerosis (MS) that involves the immune system and central nervous system (CNS). However, it is unclear how genetic predispositions promote neuroinflammation in MS and EAE. Here, we investigated how partial loss-of-function of suppressor of SMEK1facilitates the onset of MS and EAE. Smek1 deficient mice showed more severe symptoms after EAE immunization. We performed single-cell RNA sequencing (scRNA-seq) on the cortices and hippocampus from 2-month old Smek1-/- and wild type littermates. Twelve cell types were identified in 6 tissue samples. Addtionally, we found a unique microglia subtype in Smek1-/- CNS that highly express IL-1β. Further analysis revealed enrichment of macrophage Csf1 in the novel microglia cluster. These findings confirmed that with loss of function of Smek1, a novel Csf1+ microglial cluster had a preactivated phenotype that may promote neuroinflammation.
2021-08-01 | GSE171986 | GEO