Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Complete Genome Sequence of a BVDV Subgenotype 1e isolated in Italy

ABSTRACT: Complete Genome Sequence of a Bovine Viral Diarrhea Virus Subgenotype 1e Strain MA/101/05 isolated in Italy

PROVIDER: PRJEB21941 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	GCA_900199475.1_sequence_report.txt	Txt

Items per page:

1 - 1 of 1

Similar Datasets

Complete genome sequence of BVDV-1a isolated in Italy

Project description:Complete genome sequence of Bovine viral diarrhea virus sub-genotype 1a strain isolated in Italy in 2005

| PRJEB21890 | ENA

EPIC-Italy at HuGeF

Project description:This Series contains data from 845 participants (188 men and 657 women) in the EPIC-Italy cohort that was produced at the Human Genetics Foundation (HuGeF) in Turin, Italy. At the last follow-up (2010), 424 participants remained cancer-free, 235 had developed primary breast cancer, 166 had developed primary colorectal cancer, and 20 had developed other primary cancers. Anthropometric measurements, and dietary and lifestyle information obtained by questionnaire are also available.

2013-09-20 | GSE51032 | GEO

EPIC-Italy at HuGeF

2013-09-20 | E-GEOD-51032 | biostudies-arrayexpress

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

Bifidobacterium pseudocatenulatum strain:1E

Project description:Bifidobacterium pseudocatenulatum strain:1E Genome sequencing and assembly

| PRJNA349794 | ENA

Human Dental Calculus_Neolithic_Southern Italy

Project description:Characterisation of the metaproteome of a dental calculus sample extracted from a Neolithic burial, San Lorenzo Bellizzi, Italy (CS).

2023-10-24 | PXD039654 | Pride

Eggerthella lenta strain:APC055-920-1E

Project description:Eggerthella lenta strain:APC055-920-1E Genome sequencing

| PRJNA787239 | ENA

European eel Anguilla anguilla individuals from high (Tiber river, Italy) and low pollution (Bolsena lake, Italy) environments

Project description:An European eel-specific microarray platform was developed to identify genes involved in response to pollutants A comparative analysis of gene expression was conducted between European eel Anguilla anguilla individuals from high (Tiber river, Italy) and low pollution (Bolsena lake, Italy) environments. Gene expression profiling was performed using an European eel-specific oligo-DNA microarray of 14,913 probes based on single-colour detection (Cyanine-3 only). Microarrays were scanned with Agilent scanner G2565BA (barcode on the left, DNA on the back surface, scanned through the glass) at a resolution of 5 microns; all slides were scanned twice at two different sensitivity settings (XDRHi 100% and XDRLo 10%); the scanner software created a unique ID for each pair of XDR scans and saved it to both scan image files. Feature Extraction (FE) 9.5 used XDR ID to link the pairs of scans together automatically when extracting data. The signal left after all the FE processing steps have been completed is ProcessedSignal that contains the Multiplicatively Detrended, Background-Subtracted Signal.

2013-05-22 | E-GEOD-35055 | biostudies-arrayexpress

Interactome of Ca2+-bound secretagogin in INS-1E cells

Project description:By using His6-tagged recombinant human secretagogin in the presence of Ca2+ (100 µM), we precipitated putative interacting partners from INS-1E cells and identified their amino acid sequences by mass spectrometry. We detected canonical interacting proteins participating in vesicle-mediated transport, exocytosis and cytoskeletal organization. Besides, we captured proteins controlling protein folding and (de-)ubiquitination. Our data support that secretagogin modulates protein folding and degradation through protein-protein interactions and interacts with USP9X in β cells to control cell survival.

2017-06-21 | PXD006544 | Pride

Transcription profiling of rat pancreatic INS-1E cells submitted to SILAC and different glucose levels

Project description:mRNAs of INS-1E cells submitted to SILAC and different glucose levels were compared

2009-12-31 | E-TABM-477 | biostudies-arrayexpress