Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
Ontology highlight
ABSTRACT:
OTHER RELATED OMICS DATASETS IN: GSE20197
PROVIDER: PRJNA125701 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:At 7 and 10 dpi with wild type TuMV or buffer (mock) whole plants (root not included) were collected and total RNA extracted for sRNA sequencing using the Illumina plataform.
2010-04-09 | GSE20197 | GEO
Project description:Aerial parts of the rice-Arabidopsis FOX (Full-length cDNA overexpressor) lines K16331 and K19624 harboring the rice FL cDNA of LBD37 (Os-LBD37) were analyzed. LBD37 belongs to the plant- specific LOB- (Lateral Organ Boundary) domain family proteins first characterized in Arabidopsis. Results point towards an involvement of the rice LBD37 ortholog of Arabidopsis in nitrogen metabolism- related processes.
2009-12-27 | GSE14646 | GEO
Project description:In Arabidopsis thaliana, the immediate early response of plants to cytokinin is formulated as the multistep AHK-AHP-ARR phosphorelay signaling circuitry, which is initiated by the cytokinin-receptor histidine protein kinases. In the hope of finding components (or genes) that function downstream of the cytokinin-mediated His-Asp phosphorelay signaling circuitry, we carried out genome-wide microarray analyses. To this end, we focused on a pair of highly homologous ARR10 and ARR12 genes by constructing an arr10 arr12 double null mutant. The mutant alleles used in this study were arr10-5 and arr12-1. arr10-5 is the SALK_098604 T-DNA insertion line, whose mutation was determined to be located in the fifth exon of the ARR10 coding sequence. Arr12-1 is the SALK_054752 T-DNA insertion line, whose mutation was determined to be located in the third exon of the ARR12 coding sequence. The resulting mutant exhibits a characteristic phenotype with regard to the cytokinin-mediated His-Asp phosphorelay. Here we, therefore, compared response to cytokinin in wild type with that in arr10 arr12 double mutant. In this study, wild type and the arr10 arr12 double mutant grown vertically on MS agar plates for 2 weeks were treated with 20uM t-zeatin or 0.02% DMSO (solvent for t-zetion solution) for 1h. These treated plant samples were divided into three portions, from which RNA samples were prepared separately from aerial parts of seedlings with use of RNeasy Plant Mini Kit (Qiagen, Valencia, CA, U.S.A.). The Quality of RNAs prepared was analyzed by Bioanalyzer 2100 (Agilent Technologies). These RNA samples were processed as recommended by the Affymetrix instruction (Affymetrix GeneChip Expression Analysis Technical Manual, Affymetrix). These dataset will provide us with bases for understanding the early response to cytokinin on aerial parts of seedlings in Arabidopsis thaliana. Experimenter name: Hitoshi SAKAKIBARA Experimenter phone: 81455039576 Experimenter fax: 81455039609 Experimenter address: Biodynamics Research Team Experimenter address: RIKEN Plant Science Center Experimenter address: 1-7-22 Suehiro, Tsurumi Experimenter address: Yokohama Experimenter zip/postal_code: 230-0045 Experimenter country: JAPAN Keywords: compound_treatment_design;
2007-01-22 | GSE6832 | GEO
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:In Arabidopsis thaliana, the immediate early response of plants to cytokinin is formulated as the multistep AHK-AHP-ARR phosphorelay signaling circuitry, which is initiated by the cytokinin-receptor histidine protein kinases. In the hope of finding components (or genes) that function downstream of the cytokinin-mediated His-Asp phosphorelay signaling circuitry, we carried out genome-wide microarray analyses. To this end, we focused on a pair of highly homologous ARR10 and ARR12 genes by constructing an arr10 arr12 double null mutant. The mutant alleles used in this study were arr10-5 and arr12-1. arr10-5 is the SALK_098604 T-DNA insertion line, whose mutation was determined to be located in the fifth exon of the ARR10 coding sequence. Arr12-1 is the SALK_054752 T-DNA insertion line, whose mutation was determined to be located in the third exon of the ARR12 coding sequence. The resulting mutant exhibits a characteristic phenotype with regard to the cytokinin-mediated His-Asp phosphorelay. Here we, therefore, compared response to cytokinin in wild type with that in arr10 arr12 double mutant. In this study, wild type and the arr10 arr12 double mutant grown vertically on MS agar plates for 2 weeks were treated with 20uM t-zeatin or 0.02% DMSO (solvent for t-zetion solution) for 1h. These treated plant samples were divided into three portions, from which RNA samples were prepared separately from aerial parts of seedlings with use of RNeasy Plant Mini Kit (Qiagen, Valencia, CA, U.S.A.). The Quality of RNAs prepared was analyzed by Bioanalyzer 2100 (Agilent Technologies). These RNA samples were processed as recommended by the Affymetrix instruction (Affymetrix GeneChip Expression Analysis Technical Manual, Affymetrix). These dataset will provide us with bases for understanding the early response to cytokinin on aerial parts of seedlings in Arabidopsis thaliana.
2007-04-17 | E-NASC-75 | biostudies-arrayexpress
Project description:In Arabidopsis thaliana, the immediate early response of plants to cytokinin is formulated as the multistep AHK-AHP-ARR phosphorelay signaling circuitry, which is initiated by the cytokinin-receptor histidine protein kinases. In the hope of finding components (or genes) that function downstream of the cytokinin-mediated His-Asp phosphorelay signaling circuitry, we carried out genome-wide microarray analyses. To this end, we focused on a pair of highly homologous ARR10 and ARR12 genes by constructing an arr10 arr12 double null mutant. The mutant alleles used in this study were arr10-5 and arr12-1. arr10-5 is the SALK_098604 T-DNA insertion line, whose mutation was determined to be located in the fifth exon of the ARR10 coding sequence. Arr12-1 is the SALK_054752 T-DNA insertion line, whose mutation was determined to be located in the third exon of the ARR12 coding sequence. The resulting mutant exhibits a characteristic phenotype with regard to the cytokinin-mediated His-Asp phosphorelay. Here we, therefore, compared response to cytokinin in wild type with that in arr10 arr12 double mutant. In this study, wild type and the arr10 arr12 double mutant grown vertically on MS agar plates for 2 weeks were treated with 20uM t-zeatin or 0.02% DMSO (solvent for t-zetion solution) for 1h. These treated plant samples were divided into three portions, from which RNA samples were prepared separately from aerial parts of seedlings with use of RNeasy Plant Mini Kit (Qiagen, Valencia, CA, U.S.A.). The Quality of RNAs prepared was analyzed by Bioanalyzer 2100 (Agilent Technologies). These RNA samples were processed as recommended by the Affymetrix instruction (Affymetrix GeneChip Expression Analysis Technical Manual, Affymetrix). These dataset will provide us with bases for understanding the early response to cytokinin on aerial parts of seedlings in Arabidopsis thaliana. Experimenter name: Hitoshi SAKAKIBARA; Experimenter phone: 81455039576; Experimenter fax: 81455039609; Experimenter address: Biodynamics Research Team; Experimenter address: RIKEN Plant Science Center; Experimenter address: 1-7-22 Suehiro, Tsurumi; Experimenter address: Yokohama; Experimenter zip/postal_code: 230-0045; Experimenter country: JAPAN Experiment Overall Design: 12 samples were used in this experiment
2008-06-15 | E-GEOD-6832 | biostudies-arrayexpress
Project description:Aerial parts of the rice-Arabidopsis FOX (Full-length cDNA overexpressor) lines K16331 and K19624 harboring the rice FL cDNA of LBD37 (Os-LBD37) were analyzed. LBD37 belongs to the plant- specific LOB- (Lateral Organ Boundary) domain family proteins first characterized in Arabidopsis. Results point towards an involvement of the rice LBD37 ortholog of Arabidopsis in nitrogen metabolism- related processes. K16331 (T2) and empty vector control plants (T2) were grown for 18 days on solid MS- medium supplemented with 20mg/l Hygromycin. For each hybridization on Affymetrix microarrays, 2 independent plants for K16331 were used. Homozygote K19624 (T3) and empty vector control plants (T3) were grown for 18 days on solid MS- medium. For each hybridization on Affymetrix microarrays, 1 plant was used.
2009-12-26 | E-GEOD-14646 | biostudies-arrayexpress
Project description:Crude ethanolic extract of the aerial parts of Picralima nitida from Ivory Coast
2019-11-07 | MSV000084547 | GNPS
Project description:TIE1 regulates leaf development by repressing leaf differentiation because the semi-dominant mutant tie1-D by activation tagging displays small and hyponastic leaves and the differentiation of leaf epidermal cells is delayed in the tie1-D mutant, whereas disruption of TIE1 causes epinastic leaves with early differentiated epidermal cells. We used microarrays to investigate the molecular base underpinning the phenotypes of TIE1-overexpressing plants. Aerial parts of 14-day-old seedlings from wild-type and GFP-TIE1-15 were collected for RNA extraction and hybridization on Affymetrix microarrays.
2012-05-26 | E-GEOD-38282 | biostudies-arrayexpress
Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.]
2011-03-11 | GSE20278 | GEO