HLH-1 binding in muscle-enriched embryos and RNA expression in muscle-enriched embryos across different mutations
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA139037 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:This SuperSeries is composed of the following subset Series: GSE28561: Genome-wide maps of HLH-1 binding in muscle-enriched embryos. GSE28562: Genome-wide RNA expression in muscle-enriched embryos across different mutations. Refer to individual Series
2012-06-21 | E-GEOD-28563 | biostudies-arrayexpress
Project description:To investigate the structure of the bodywall muscle differentiation network, we sought to both identify what role HLH-1 binding has in this regulation. We mapped the relationship between the regulatory targets and HLH-1 binding, as measured by ChIP-seq in animals enriched for bodywall muscle tissue through RNAi feeding. While regulatory targets are enriched for HLH-1 binding, the majority of HLH-1 binding actually occurs away from genes that are affected by hlh-1 loss of function. Nevertheless, HLH-1 binding is associated with both the expected E-box and, near genes belonging to specific regulatory subgroups, novel motifs that may serve as binding sites for cooperative transcription factors. HLH-1 binding genome-wide in the early embryo of C. elegans
2012-06-21 | E-GEOD-28561 | biostudies-arrayexpress
Project description:To investigate the structure of the bodywall muscle differentiation network, we sought to both identify what role HLH-1 binding has in this regulation. We mapped the relationship between the regulatory targets and HLH-1 binding, as measured by ChIP-seq in animals enriched for bodywall muscle tissue through RNAi feeding. While regulatory targets are enriched for HLH-1 binding, the majority of HLH-1 binding actually occurs away from genes that are affected by hlh-1 loss of function. Nevertheless, HLH-1 binding is associated with both the expected E-box and, near genes belonging to specific regulatory subgroups, novel motifs that may serve as binding sites for cooperative transcription factors.
2012-06-22 | GSE28561 | GEO
Project description:To investigate the structure of the bodywall muscle differentiation network, we sought to both identify what these transcription factors regulate in bodywall muscle. Through loss of function analysis, we identified genome-wide regulatory targets of hlh-1 and unc-120 using RNA-seq. 1445 targets of hlh-1 and 3674 targets of unc-120 were identified, with 760 of these genes being targets of both. Crosstalk was identified between the networks of hlh-1 and hlh-8, which is involved in non-bodywall muscle development. In the process, we quantified bodywall muscle RNA. Our data suggest that shared target genes and overlapping regulation buffer the hlh-1 and unc-120 mutant phenotypes.
2012-06-22 | GSE28562 | GEO
Project description:To investigate the structure of the bodywall muscle differentiation network, we sought to both identify what these transcription factors regulate in bodywall muscle. Through loss of function analysis, we identified genome-wide regulatory targets of hlh-1 and unc-120 using RNA-seq. 1445 targets of hlh-1 and 3674 targets of unc-120 were identified, with 760 of these genes being targets of both. Crosstalk was identified between the networks of hlh-1 and hlh-8, which is involved in non-bodywall muscle development. In the process, we quantified bodywall muscle RNA. Our data suggest that shared target genes and overlapping regulation buffer the hlh-1 and unc-120 mutant phenotypes. RNA expression genome-wide in the early embryo
2012-06-21 | E-GEOD-28562 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the SubSeries listed below.
2012-06-22 | GSE28563 | GEO
Project description:Background: ; The force generating mechanism of muscle is evolutionarily ancient; the fundamental structural and functional components of the sarcomere are common to motile animals throughout phylogeny. Recent evidence suggests that the transcription factors that regulate muscle development are also conserved. Thus, a comprehensive description of muscle gene expression in a simple model organism should define a basic muscle transcriptome that is also expressed in animals with more complex body plans. To this end, we have applied Micro-Array Profiling of C. elegans (MAPCeL) to muscle cell populations extracted from developing C. elegans embryos. Results: ; Fluorescence Activated Cell Sorting (FACS) was used to isolate myo-3::GFP-positive muscle cells, and their cultured derivatives, from dissociated early C. elegans embryos. Microarray analysis identified 6,693 expressed genes, 1,324 of which are enriched in the myo-3::GFP positive cell population relative to the average embryonic cell. The muscle-enriched gene set was validated by comparisons to known muscle markers, independently derived expression data, and GFP reporters in transgenic strains. These results confirm the utility of MAPCeL for cell type-specific expression profiling and reveal that 60% of these transcripts have human homologs. Conclusions: ; This study provides a comprehensive description of gene expression in developing C. elegans embryonic muscle cells. The finding that over half of these muscle-enriched transcripts encode proteins with human homologs suggests that mutant analysis of these genes in C. elegans could reveal evolutionarily conserved models of muscle gene function with ready application to human muscle pathologies. Experiment Overall Design: Approximately 80 one- and two-cell stage embryos were collected from either heat-shock hlh-1 (KM267) or heat-shock pal-1(JA1179) worms and were incubated for 20 min (hs pal-1) or 60 min (hs hlh-1) at room temperature prior to a heat pulse at 34oC for 30min. After the heat pulse, embryos were incubated at room temperature for 2, 4, and 6 hours (hs hlh-1) or 2, 4, 6, and 8 hours (hs pal-1) prior to total RNA isolation. Embryos were also collected prior to heat shock as a control (0 hour). Triplicate independent samples were prepared for all time points. All hs pal-1 experiments were performed on embryos derived from skn-1, pop-1 double RNAi injected animals. The isolation of total RNA from embryos followed the procedures in (Baugh et al. 2003). Total RNA was used with the Super Smart PCR cDNA synthesis kit (BD Clontech) in 20 cycles with a modified primer (SMART7T27 Primer: 5'-TGAAGCAGTGGTAACAACGCAGAGTAATACGACTCACTATAGGGAGAAGC(T)27VN -3') prior to one cycle target labeling reaction by standard procedures (Affymetrix). Affymetrix C. elegans gene chips (P/N900383, ~22,500 transcript probes) were processed according to manufactures protocol using the NIDDK Genomics Core Laboratory. Microarray data was normalized by MAS5 prior to analysis using GeneSpring software (Silicon Genetics).
2008-06-16 | E-GEOD-8231 | biostudies-arrayexpress
Project description:modENCODE_submission_2431 This submission comes from a modENCODE project of Michael Snyder. For full list of modENCODE projects, see http://www.genome.gov/26524648 Project Goal: We are identifying the DNA binding sites for 300 transcription factors in C. elegans. Each transcription factor gene is tagged with the same GFP fusion protein, permitting validation of the gene's correct spatio-temporal expression pattern in transgenic animals. Chromatin immunoprecipitation on each strain is peformed using an anti-GFP antibody, and any bound DNA is deep-sequenced using Solexa GA2 technology. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf EXPERIMENT TYPE: CHIP-seq. BIOLOGICAL SOURCE: Strain: OP64(made_by : R. Waterston description : This strain's transgene was constructed by Mihail Sarov at the Max Planck Institute for Cell Biology in Tubiginen using Tony Hyman's recombineering pipeline. The resulting plasmid was used for biolistic transformation of an unc-119(ed3) strain. The HLH-1::EGFP fusion protein is expressed in the correct hlh-1 spatio-temporal expression pattern. This strain was used for ChIP-seq experiments to map the in vivo binding sites for the HLH-1 transcription factor. tags : GFP::3xFlag mutagen : Bombard outcross : 3 genotype : unc-119(ed3) III; wgIs64 [unc-119(+) hlh-1::TY1::EGFP::3xFLAG] official name : OP64 ); Developmental Stage: embryo; Genotype: unc-119(ed3) III; wgIs64 [unc-119(+) hlh-1::TY1::EGFP::3xFLAG]; Sex: Hermaphrodite; EXPERIMENTAL FACTORS: Developmental Stage embryo; Target gene hlh-1; Strain OP64(made_by : R. Waterston description : This strain's transgene was constructed by Mihail Sarov at the Max Planck Institute for Cell Biology in Tubiginen using Tony Hyman's recombineering pipeline. The resulting plasmid was used for biolistic transformation of an unc-119(ed3) strain. The HLH-1::EGFP fusion protein is expressed in the correct hlh-1 spatio-temporal expression pattern. This strain was used for ChIP-seq experiments to map the in vivo binding sites for the HLH-1 transcription factor. tags : GFP::3xFlag mutagen : Bombard outcross : 3 genotype : unc-119(ed3) III; wgIs64 [unc-119(+) hlh-1::TY1::EGFP::3xFLAG] official name : OP64 ); temp (temperature) 20 degree celsius Series_type: CHIP-seq
2011-02-18 | E-GEOD-25784 | biostudies-arrayexpress
Project description:The hlh-30 gene encodes a C. elegans basic-helix-loop-helix (bHLH) transcription factor; We compared RNA from wild type worms and worms mutant for the hlh-30 gene to identify putative target genes of the HLH-30 transcription factor. Experiment Overall Design: Total RNA from three biological replicates were isolated from embryos, L1 larvae, and L2 larvae from both wild type and hlh-30(tm1978) mutant worms
2009-08-07 | E-GEOD-15762 | biostudies-arrayexpress
Project description:Background: The force generating mechanism of muscle is evolutionarily ancient; the fundamental structural and functional components of the sarcomere are common to motile animals throughout phylogeny. Recent evidence suggests that the transcription factors that regulate muscle development are also conserved. Thus, a comprehensive description of muscle gene expression in a simple model organism should define a basic muscle transcriptome that is also expressed in animals with more complex body plans. To this end, we have applied Micro-Array Profiling of C. elegans (MAPCeL) to muscle cell populations extracted from developing C. elegans embryos. Results: Fluorescence Activated Cell Sorting (FACS) was used to isolate myo-3::GFP-positive muscle cells, and their cultured derivatives, from dissociated early C. elegans embryos. Microarray analysis identified 6,693 expressed genes, 1,324 of which are enriched in the myo-3::GFP positive cell population relative to the average embryonic cell. The muscle-enriched gene set was validated by comparisons to known muscle markers, independently derived expression data, and GFP reporters in transgenic strains. These results confirm the utility of MAPCeL for cell type-specific expression profiling and reveal that 60% of these transcripts have human homologs. Conclusions: This study provides a comprehensive description of gene expression in developing C. elegans embryonic muscle cells. The finding that over half of these muscle-enriched transcripts encode proteins with human homologs suggests that mutant analysis of these genes in C. elegans could reveal evolutionarily conserved models of muscle gene function with ready application to human muscle pathologies. Keywords: time course, muscle cells, HLH-1 induction
2007-11-08 | GSE8231 | GEO