Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:In the present study, we studied microbial composition and metabolic activity in the bathypelagic zone of the South China Sea. 12 samples were collected and subjected to metaproteomic analysis. Our data provide a novel view of the roles of two lifestyle prokaryotes and their link in substrate utilization in dark ocean.
Project description:In the present study, we studied microbial composition and metabolic activity in the euphotic zone of the South China Sea. 8 samples were collected and subjected to metaproteomic analysis. Our results suggested that mixotrophic phototrophs-driven NDL carbon fixation along with phytoplankton-driven NRL carbon fixation determined primary production in the oligotrophic ocean’s euphotic zone.
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
Project description:we applied metaproteomic approach to capture proteins from three size-fractionated microbial communities at the DCM in the basin of the South China Sea. The deep recovery of proteomes from a marine DCM plankton assemblage provides the highest resolution of metabolic activities as well as microbial niche differentiation, revealing a spectrum of biological processes carrying out by microbes at DCM of the SCS.
Project description:Sulfur metabolism in the deep-sea cold seep has been mentioned to have an important contribution to the biogeochemical cycle of sulfur in previous studies. And sulfate reducing bacteria have also been considered to be a dominant microbial population in the deep-sea cold seep and play a crucial role in this process. However, most of sulfate reducing bacteria from cold seep still cannot be purely cultured under laboratory conditions, therefore the actual sulfur metabolism pathways in sulfate reducing bacteria from the deep-sea cold seep have remained unclear. Here, we isolate and pure culture a typical sulfate reducing bacterium Desulfovibrio marinus CS1 from the sediment sample of the deep-sea cold seep in the South China Sea, which provides a probability to understand the sulfur metabolism in the cold seep.
Project description:Viral concentrates (VCs) contained both viral particles and cell-affiliated components. In this study, a shotgun metaproteomic approach was applied to characterize proteins in the VCs collected from chlorophyll maximum, mesopelagic (200 m) and bathypelagic (3000 m) waters in the South China Sea. Abundant viral proteins indicated the shift of viral community as depth. Whereas the remaining non-viral proteins suggested the diverse microbial metabolism distinct at different layers.
2022-01-19 | PXD020896 | Pride
Project description:16S rRNA gene amplicon sequencing of sea water samples from offshore China
