Ontology highlight
ABSTRACT:
PROVIDER: PRJNA606622 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Gas hydrates, also known as clathrates, are cages of ice-like water crystals encasing gas molecules such as methane (CH4). Despite the global importance of gas hydrates, their microbiomes remain mysterious. Microbial cells are physically associated with hydrates, and the taxonomy of these hydrate-associated microbiomes is distinct from non-hydrate-bearing sites. Global 16S rRNA gene surveys show that members of sub-clade JS-1 of the uncultivated bacterial candidate phylum Atribacteria are the dominant taxa in gas hydrates. The Atribacteria phylogeny is highly diverse, suggesting the potential for wide functional variation and niche specialization. Here, we examined the distribution, phylogeny, and metabolic potential of uncultivated Atribacteria in cold, salty, and high-pressure sediments beneath Hydrate Ridge, off the coast of Oregon, USA, using a combination of 16S rRNA gene amplicon, metagenomic, and metaproteomic analysis. Methods were developed to extract bacterial cellular protein from these sediments, as outlined below. Sample Description Three sediments samples were collected from beneath Hydrate Ridge, off the coast of Oregon, USA. Sediments were cored at ODP site 1244 (44°35.1784´N; 125°7.1902´W; 895 m water depth) on the eastern flank of Hydrate Ridge ~3 km northeast of the southern summit on ODP Leg 204 in 2002 and stored at -80°C at the IODP Gulf Coast Repository. E10H5 sediment is from 68.5 meters below sediment surface interface C1H2 sediment is from 2 meters below sediment surface interface. C3H4 sediment is from 21 meters below sediment surface interface.
2020-01-22 | PXD012479 | Pride
Project description:16s RNA gene sequencing data from seawater, bed sediment and steel corrosion samples from Shoreham Harbour, UK, collected to allow bacterial species comparisons between microbially influenced corrosion, the surrounding seawater, and the sea bed sediment at the seafloor and 50cm depth below seafloor.
2019-10-06 | E-MTAB-8373 | biostudies-arrayexpress
Project description:The characterization of microbial community structure via 16S rRNA gene profiling has been greatly advanced in recent years by the application of amplicon pyrosequencing. The possibility of barcode-tagged sequencing of templates gives the opportunity to massively screen multiple samples from environmental or clinical sources for community details. However, an on-going debate questions the reproducibility and semi-quantitative rigour of pyrotag sequencing and, as in the early days of genetic community fingerprinting, pros and cons are continuously provided. In this study we investigate the reproducibility of bacterial 454 pyrotag sequencing over biological and technical replicates of natural microbiota. Moreover, via quantitatively defined template spiking to the natural community, we explore the potential for recovering specific template ratios within complex microbial communities. For this reason, we pyrotag sequenced three biological replicates of three samples, each belonging from yearly sampling campaigns of sediment from a tar oil contaminated aquifer in Düsseldorf, Germany. Furthermore, we subjected one DNA extract to replicate technical analyses as well as to increasing ratios (0, 0.2, 2 and 20%) of 16S rRNA genes from a pure culture (Aliivibrio fisheri) originally not present in the sample. Unexpectedly, taxa abundances were highly reproducible in our hands, with max standard deviation of ~3% abundance across biological and ~2% for technical replicates. Furthermore, our workflow was also capable of recovering A. fisheri amendmend ratios in reliable amounts (0, 0.29, 3.9 and 23.8%). These results highlight that pyrotag sequencing, if done and evaluated with due caution, has the potential to robustly recapture taxa template abundances within environmental microbial communities. 9 Biological and 3 technical replicates were evaluated, as well as potential to recover qPCR-defined ratios of DNA, in 454 pyrotag sequencing
2012-07-16 | E-GEOD-35631 | biostudies-arrayexpress
Project description:Sulfur metabolism in the deep-sea cold seep has been mentioned to have an important contribution to the biogeochemical cycle of sulfur in previous studies. And sulfate reducing bacteria have also been considered to be a dominant microbial population in the deep-sea cold seep and play a crucial role in this process. However, most of sulfate reducing bacteria from cold seep still cannot be purely cultured under laboratory conditions, therefore the actual sulfur metabolism pathways in sulfate reducing bacteria from the deep-sea cold seep have remained unclear. Here, we isolate and pure culture a typical sulfate reducing bacterium Desulfovibrio marinus CS1 from the sediment sample of the deep-sea cold seep in the South China Sea, which provides a probability to understand the sulfur metabolism in the cold seep.
2024-06-16 | PXD023247 | Pride
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:The characterization of microbial community structure via 16S rRNA gene profiling has been greatly advanced in recent years by the application of amplicon pyrosequencing. The possibility of barcode-tagged sequencing of templates gives the opportunity to massively screen multiple samples from environmental or clinical sources for community details. However, an on-going debate questions the reproducibility and semi-quantitative rigour of pyrotag sequencing and, as in the early days of genetic community fingerprinting, pros and cons are continuously provided. In this study we investigate the reproducibility of bacterial 454 pyrotag sequencing over biological and technical replicates of natural microbiota. Moreover, via quantitatively defined template spiking to the natural community, we explore the potential for recovering specific template ratios within complex microbial communities. For this reason, we pyrotag sequenced three biological replicates of three samples, each belonging from yearly sampling campaigns of sediment from a tar oil contaminated aquifer in Düsseldorf, Germany. Furthermore, we subjected one DNA extract to replicate technical analyses as well as to increasing ratios (0, 0.2, 2 and 20%) of 16S rRNA genes from a pure culture (Aliivibrio fisheri) originally not present in the sample. Unexpectedly, taxa abundances were highly reproducible in our hands, with max standard deviation of ~3% abundance across biological and ~2% for technical replicates. Furthermore, our workflow was also capable of recovering A. fisheri amendmend ratios in reliable amounts (0, 0.29, 3.9 and 23.8%). These results highlight that pyrotag sequencing, if done and evaluated with due caution, has the potential to robustly recapture taxa template abundances within environmental microbial communities.
2012-07-16 | GSE35631 | GEO