Ontology highlight
ABSTRACT:
PROVIDER: PRJNA392434 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR5785960_1.fastq.gz | Fastqsanger.gz | |||
| SRR5785960_2.fastq.gz | Fastqsanger.gz | |||
| SRR5785970_1.fastq.gz | Fastqsanger.gz | |||
| SRR5785970_2.fastq.gz | Fastqsanger.gz | |||
| SRR5785980_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 80 |
Similar Datasets
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:The hormonal contraceptive medroxyprogesterone acetate (MPA) is associated with increased risk of human immunodeficiency virus (HIV), via incompletely understood mechanisms. Increased diversity in the vaginal microbiota modulates genital inflammation and is associated with increased HIV-1 acquisition. However, the effect of MPA on diversity of the vaginal microbiota is relatively unknown. In a cohort of female Kenyan sex workers, negative for sexually transmitted infections (STIs), with Nugent scores <7 (N=58 of 370 screened), MPA correlated with significantly increased diversity of the vaginal microbiota as assessed by 16S rRNA gene sequencing. MPA was also significantly associated with decreased levels of estrogen in the plasma, and low vaginal glycogen and α-amylase, factors implicated in vaginal colonization by lactobacilli, bacteria that are believed to protect against STIs. In a humanized mouse model, MPA treatment was associated with low serum estrogen, low glycogen and enhanced HIV-1 susceptibility. The mechanism by which the MPA mediated changes in the vaginal microbiota may contribute to HIV-1 susceptibility in humans appears to be independent of inflammatory cytokines and/or activated T cells. Altogether, these results suggest MPA-induced hypo-estrogenism may alter key metabolic components that are necessary for vaginal colonization by certain bacterial species including lactobacilli, and allow for greater bacterial diversity in the vaginal microbiota.
2019-10-17 | GSE138971 | GEO
Project description:Interventions: Follow-up observation group:no;A drug maintenance treatment group:no;Two kinds of drugs maintenance treatment group:no
Primary outcome(s): 16s rRNA sequencing results;Evaluation of therapeutic response in solid tumors
Study Design: Cohort study
| 105717 | ecrin-mdr-crc
Project description:Evaluation of 5 primer sets for the characterization of the gut mycobiome
| PRJEB29038 | ENA
Project description:This study aimed to model formamide-based melting for the optimization of the sensitivity and specifcity of oligonucleotide probes in dignostic high-density microarrays. Formamide melting profiles of DNA oligonucleotides were obtained with a high-density microarray targeting 16S rRNA genes of Escherichia coli and Rhodobacter sphaeroides. One or two mismatched versions of perfect match probes were included on the array to systematically analyze the effect of formamide on mismatch stability and mismatch discrimination. A thermodynamics-based mathematical model of formamide denaturation was developed to predict the formamide melting profiles with sufficient accuracy to help with oligonucleotide design in microbial ecology applications. 16S rRNA sequences with GenBank accession codes U00006 ( E. coli ) and X53853 (R. sphaeroides) were used for probe design. The following oligonucleotide probe sets were used for the systematic analysis of the effect of formamide on probe-target hybrids (parenthetic information gives set name followed by the number of probes): 22-mer perfect match probes tiling the 16S rRNA gene of E. coli (TileE, n=1521), perfect match E.coli probes of variable length between 18 and 26 mers (Length, n=1045), E. coli probes with central single mismatches (OneM, n=1563), E. coli probes with single positional mismatches (PosM, n=4092), E. coli probes with single deletion mismatches (Gap, n=248), E. coli probes with single insertion mismatches (Insertion, n=248), E. coli probes with two separate mismatches (TwoM, n=1674), E. coli probes with central tandem mismatches (Tandem, n=558), and 22-mer perfect match probes tiling the 16S rRNA gene of R. sphaeroides. Also, a probe with no match to 16S rRNA genes was used as a background control. On the array, regular probes were replicated three times and the Nonsense probe ten times. See the manuscript of Yilmaz et al. for details.
2012-06-29 | E-GEOD-33021 | biostudies-arrayexpress
Project description:Interventions: Experimental group:Dietary fiber;Control:Non-Dietary fiber
Primary outcome(s): Hgb, ALB, PAB, TRF, LYM, CD3+, CD3+CD4+, CD3+CD8+, CD16+CD56+, CD19+, IgA, IgG, IgM;16S rRNA gene v3v4 variable region
Study Design: Randomized parallel controlled trial
| 2666161 | ecrin-mdr-crc
Project description:A lactobacilli dominated microbiota in most pre and post-menopausal women is an indicator of vaginal health. A Nugent scoring system serves as a proxy for determining the ratio of lactobacilli to other vaginal inhabitants where a high score usually represents a diseased state, whilst an intermediate score represents a warning zone. The objective of this double blinded, placebo-controlled crossover study was to evaluate in 14 post-menopausal women with an intermediate score, the effect of vaginal administration of probiotic L. rhamnosus GR-1 and L. reuteri RC-14 on the microbiota and host response. The probiotic treatment did not result in changes to clinical parameters such as dryness, irritation and comfort, compared to when placebo was applied. Analysis using 16S rRNA sequencing and metabolomics profiling revealed that the proportional abundance of Lactobacillus was increased following probiotic administration as compared to placebo, which was weakly associated with an increase in lactate levels. Analysis of host responses by microarray showed the probiotics had an immune-modulatory response and multiplex cytokine analysis showed up-regulation of IL-5. This is the first study to use an interactomic approach for the study of vaginal probiotic administration in post-menopausal women. It shows that in some cases multifaceted approaches are required to detect the subtle trigger molecular changes induced by the host to instillation of probiotic strains. A total of 35 total RNA samples extracted from vaginal brushes were analyzed on Affymetrix Gene 2.0 ST arrays from 14 Participants collected over multiple visits including administration of either a probiotic supplement or placebo control.
2014-07-20 | E-GEOD-54363 | biostudies-arrayexpress
Project description:<p>Archived self-collected vaginal swabs were utilized from a pilot study of vaginal douching cessation (NIH/NIAID R03-AI061131). Thirty-nine non-pregnant, reproductive-age women who reported the use of vaginal douche products in the two months prior to screening were enrolled. Thirty-three of these successfully completed the 16-week longitudinal study. Participants self-collected vaginal swabs and smears twice weekly. We report sequences based on the analysis of 16S rRNA gene sequences amplified from whole genomic DNA isolated from the swabs. Bacterial vaginosis (BV) is defined by Gram's stain of vaginal fluid (Nugent's score ≥7).</p> <p>The large body of information generated will facilitate understanding of vaginal microbial community dynamics, the etiology of BV, and drive the development of better diagnostic tools for BV. Furthermore, it is hoped that the information will enable a more personalized treatment of BV and ultimately, prevent adverse sequelae associated with BV.</p>
| phs000261 | dbGaP