Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Benchmark of 16S analysis with V12 and V34 primer sets

PROVIDER: PRJNA715083 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR13985700_1.fastq.gz	Fastqsanger.gz
	SRR13985700_2.fastq.gz	Fastqsanger.gz
	SRR13985800_1.fastq.gz	Fastqsanger.gz
	SRR13985800_2.fastq.gz	Fastqsanger.gz
	SRR13985900_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 768

Similar Datasets

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:In Silico Analysis and Experimental Evaluation of Primer Sets for Species Level Resolution of Vaginal Microbiota using 16S rRNA Gene Sequencing

| PRJNA392434 | ENA

Metagenome benchmark

Project description:Benchmark of metagenome analysis tools

| PRJEB8286 | ENA

Fungi Methods

Project description:Evaluation of 5 primer sets for the characterization of the gut mycobiome

| PRJEB29038 | ENA

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

genesorteR: Feature Ranking in Clustered Single Cell Data

Project description:Marker genes identified in single cell experiments are expected to be highly specific to a certain cell type and highly expressed in that cell type. Detecting a gene by differential expression analysis does not necessarily satisfy those two conditions and is typically computationally expensive for large cell numbers. Here we present genesorteR, an R package that ranks features in single cell data in a manner consistent with the expected definition of marker genes in experimental biology research. We benchmark genesorteR using various data sets and show that it is distinctly more accurate in large single cell data sets compared to other methods. genesorteR is orders of magnitude faster than current implementations of differential expression analysis methods, can operate on data containing millions of cells and is applicable to both single cell RNA-Seq and single cell ATAC-Seq data. genesorteR is available at https://github.com/mahmoudibrahim/genesorteR.

2020-09-30 | GSE136950 | GEO

Project description:Analysis of V3V4 16s rRNA primer systems for profiling thermophilic microbial communities

| PRJNA546132 | ENA

Transcriptome of human foetal heart for comparison with cardiomyocytes from pluripotent stem cells

Project description:Gene expression in the human foetal heart for a comparison with cardiomyocytes derived from human pluripotent stem cells. Human foetal heart samples were collected from the individual chambers of the heart at various stages of development. This provided the opportunity to perform gene expression analysis and identify genes involved in the formation of the heart in each of the four chambers and at different stages of development. The dataset can be used to benchmark human pluripotent stem cell derived cardiomyocytes (hPSC-CMs) in terms of their maturation state by comparing it to the foetal heart samples. Two commercially available reference RNA sets are included in the analysis in order to characterize future sets of hPSC-CMs.

2015-07-22 | GSE71148 | GEO

16S Sequencing in woman subjected to Assisted Reproductive Technologies

Project description:We performed a 16S sequencing analysis on Cervical Swab of women undergoing Assisted Reproductive Technologies

2023-11-17 | E-MTAB-11151 | biostudies-arrayexpress