Primate cell fusion disentangles gene regulatory divergence in neural development
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA605139 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Among primates, humans display a unique trajectory of development responsible for the many traits specific to our species. However, the inaccessibility of human and chimpanzee primary tissues has limited our ability to study human evolution. Comparative in vitro approaches using primate-derived induced pluripotent stem cells have begun to reveal species differences on the cellular and molecular levels. In particular, brain organoids have emerged as a promising platform to study primate neural development in vitro, although cross-species comparisons of organoids are complicated by differences in developmental timing and variability of differentiation. Here, we developed a new platform to address these limitations. We first generated a panel of tetraploid hybrid stem cells by fusing human and chimpanzee induced pluripotent stem cells. We next applied this approach to study species divergence in cerebral cortical development by differentiating them into neural organoids. We found that hybrid organoids provide a controlled system for disentangling cis- and trans-acting gene expression divergence across cell types and developmental stages, revealing a signature of selection on astrocyte-related genes. In addition, we identified an up-regulation of human somatostatin receptor 2 (SSTR2), which regulates neuronal calcium signaling and is associated with neuropsychiatric disorders. We discovered a human-specific response to modulation of SSTR2 function in cortical neurons, underscoring the potential of this unique platform to reveal the molecular basis of human evolution.
2020-11-17 | GSE144825 | GEO
Project description:Neural divergence and hybrid disruption between ecologically isolated Heliconius butterflies
| PRJEB42387 | ENA
Project description:Here we derive human and chimpanzee cranial neural crest cells (CNCCs) and profile histone modifications, transcription factors, chromatin accessibility and gene expression to systematically and quantitatively annotate evolutionary divergence of craniofacial cis-regulatory landscapes.
2015-09-11 | GSE70751 | GEO
Project description:Among primates, humans display a unique trajectory of development that is responsible for the many traits specific to our species. However, the inaccessibility of primary human and chimpanzee tissues has limited our ability to study human evolution. Comparative in vitro approaches using primate-derived induced pluripotent stem cells have begun to reveal species differences on the cellular and molecular levels1,2. In particular, brain organoids have emerged as a promising platform to study primate neural development in vitro3-5, although cross-species comparisons of organoids are complicated by differences in developmental timing and variability of differentiation6,7. Here we develop a new platform to address these limitations by fusing human and chimpanzee induced pluripotent stem cells to generate a panel of tetraploid hybrid stem cells. We applied this approach to study species divergence in cerebral cortical development by differentiating these cells into neural organoids. We found that hybrid organoids provide a controlled system for disentangling cis- and trans-acting gene-expression divergence across cell types and developmental stages, revealing a signature of selection on astrocyte-related genes. In addition, we identified an upregulation of the human somatostatin receptor 2 gene (SSTR2), which regulates neuronal calcium signalling and is associated with neuropsychiatric disorders8,9. We reveal a human-specific response to modulation of SSTR2 function in cortical neurons, underscoring the potential of this platform for elucidating the molecular basis of human evolution.
| S-EPMC8719633 | biostudies-literature
Project description:Here we derive human and chimpanzee cranial neural crest cells (CNCCs) and profile histone modifications, transcription factors, chromatin accessibility and gene expression to systematically and quantitatively annotate evolutionary divergence of craniofacial cis-regulatory landscapes. Histone modifications (H3K27ac, H3K4me1, H3K4me3, H3K27me3), chromatin modifiers (p300), transcription factors (NR2F1, TFAP2A), chromatin accessibility (ATACseq) and gene expression (RNAseq) were assayed in CNCCs derived from iPSCs/ESCs from 2 chimpanzee and 3 human individuals.
2015-09-11 | E-GEOD-70751 | biostudies-arrayexpress
Project description:Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest
| PRJNA289483 | ENA
Project description:Developing a model of primate neural tube (NT) development is important to promote many NT disorder studies in model organisms. Here, we report a robust and stable system to allow for clonal expansion of single monkey neuroepithelial stem cells (NESCs) to develop into miniature NT-like structures. Single NESCs can produce functional neurons in vitro, survive and extensively regenerate neuron axons in monkey brain. NT formation and NESC maintenance depend on high metabolism activity and Wnt signaling. NESCs are regionally restricted into a telencephalic fate. Moreover, single NESCs can turn into radial glial progenitors (RGPCs). The transition is accurately regulated by Wnt signaling through regulation of Notch signaling and adhesion molecules. Finally, using the â??NESC-TO-NTsâ?? system, we model the functions of folic acid (FA) on NT closure and demonstrate FA can regulate multiple mechanisms to prevent NT defects. Together, our system is ideal for studying NT development and diseases. compare gene expression profiles in monkey neuroepithelial stem cells (NESCs), newly converted radial glial progenitor cells (RPGCs) from NESCs and differentiated neurons from NESCs
2015-11-21 | E-GEOD-73892 | biostudies-arrayexpress
Project description:Regulatory divergence during limb evolution
| PRJNA521485 | ENA
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:Developing a model of primate neural tube (NT) development is important to promote many NT disorder studies in model organisms. Here, we report a robust and stable system to allow for clonal expansion of single monkey neuroepithelial stem cells (NESCs) to develop into miniature NT-like structures. Single NESCs can produce functional neurons in vitro, survive and extensively regenerate neuron axons in monkey brain. NT formation and NESC maintenance depend on high metabolism activity and Wnt signaling. NESCs are regionally restricted into a telencephalic fate. Moreover, single NESCs can turn into radial glial progenitors (RGPCs). The transition is accurately regulated by Wnt signaling through regulation of Notch signaling and adhesion molecules. Finally, using the “NESC-TO-NTs” system, we model the functions of folic acid (FA) on NT closure and demonstrate FA can regulate multiple mechanisms to prevent NT defects. Together, our system is ideal for studying NT development and diseases.
2015-11-21 | GSE73892 | GEO