Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Human fecal microbiome

ABSTRACT: The compatibility evaluation of V3V4 and V4 16S-amplicon libraries

PROVIDER: PRJNA643648 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR12141637_1.fastq.gz	Fastqsanger.gz
	SRR12141637_2.fastq.gz	Fastqsanger.gz
	SRR12141638_1.fastq.gz	Fastqsanger.gz
	SRR12141638_2.fastq.gz	Fastqsanger.gz
	SRR12141639_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 104

Similar Datasets

Fecal microbiota in mice before and after repeated mild stress

Project description:To examine potential changes of the intestinal microbiota in mice caused by repeated mild stress, we profiled bacteria and fungi in the mouse feces by sequencing the 16s v3v4 region and the ITS1-2 region.

2024-09-23 | GSE222533 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Human fecal microbiota

Project description:V4 16S rRNA sequencing of human fecal microbiota Raw sequence reads

| PRJNA386260 | ENA

Mus musculus strain:C576BL/J

Project description:16S rRNA V3V4 amplicon seq of CBD

| PRJDB13331 | ENA

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

2013-06-25 | E-GEOD-42426 | biostudies-arrayexpress

7a75f7bd-831c-4b1a-9a69-e36963fb9e78 - samples

Project description:Amplicon sequencing from 45 samples - Amplicons of 16s v3-v4

| EGAD00001005027 | EGA