Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [hESM01]

ABSTRACT: Genome-wide contacts of rDNA units detected by 4C procedure in human genome [hESM01]

PROVIDER: PRJNA734287 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR14701221.fastq.gz	Fastqsanger.gz
	SRR14701222.fastq.gz	Fastqsanger.gz

Items per page:

1 - 2 of 2

Similar Datasets

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [K562]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in K562 cells.

2021-08-11 | GSE175910 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs]

Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-05 | GSE121417 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [hESM01]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in hESM01 cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2021-08-11 | GSE175909 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-03 | GSE121413 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).

2022-12-01 | GSE121363 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome

Project description:Genome-wide contacts of rDNA units detected by 4C procedure in human genome

| PRJNA497289 | ENA

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs]

Project description:Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs]

| PRJNA497288 | ENA

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [K562]

Project description:Genome-wide contacts of rDNA units detected by 4C procedure in human genome [K562]

| PRJNA734290 | ENA

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]

Project description:Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]