Project description:Comparison of probe-target dissociations of probe Eub338 and Gam42a with native RNA of P. putida, in vitro transcribed 16s rRNA of P. putida, in vitro transcribed 16S rRNA of a 2,4,6-trinitrotoluene contaminated soil and an uncontaminated soil sample. Functional ANOVA revealed no significant differences in the dissociation curves of probe Eub338 when hybridised to the different samples. On the opposite, the dissociation curve of probe Gam42a with native RNA of P. putida was significantly different than the dissociation curves obtained with in vitro transcribed 16S rRNA samples. Keywords: Microbial diversity, thermal dissociation analysis, CodeLink microarray
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction A ten chip study using PCR amplicons from cloned 16S rRNA genes and from diverse soil 16S rRNAs, with PCR primers specific to the Division Acidobacteria. Each chip measures the signal from 42,194 probes (in triplicate) targeting Acidobacteria division, subdivision, and subclades as well as other bacterial phyla. All samples except one (GSM464591) include 2.5 M betaine in the hybridization buffer. Pair files lost due to a computer crash.
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:High throughput sequencing of bacterial 16S rRNA in wetland soil
Project description:We aimed to investigate the microbial community composition in patients with intracerebral hemorrhage (ICH) and its effect on prognosis. The relationship between changes in bacterial flora and the prognosis of spontaneous cerebral hemorrhage was studied in two cohort studies. Fecal samples from healthy volunteers and patients with intracerebral hemorrhage were subjected to 16S rRNA sequencing at three time points: T1 (within 24 hours of admission), T2 (3 days post-surgery), and T3 (7 days post-surgery) using Illumina high-throughput sequencing technology.
