Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
Project description:Comparison of probe-target dissociations of probe Eub338 and Gam42a with native RNA of P. putida, in vitro transcribed 16s rRNA of P. putida, in vitro transcribed 16S rRNA of a 2,4,6-trinitrotoluene contaminated soil and an uncontaminated soil sample. Functional ANOVA revealed no significant differences in the dissociation curves of probe Eub338 when hybridised to the different samples. On the opposite, the dissociation curve of probe Gam42a with native RNA of P. putida was significantly different than the dissociation curves obtained with in vitro transcribed 16S rRNA samples. Keywords: Microbial diversity, thermal dissociation analysis, CodeLink microarray
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction A ten chip study using PCR amplicons from cloned 16S rRNA genes and from diverse soil 16S rRNAs, with PCR primers specific to the Division Acidobacteria. Each chip measures the signal from 42,194 probes (in triplicate) targeting Acidobacteria division, subdivision, and subclades as well as other bacterial phyla. All samples except one (GSM464591) include 2.5 M betaine in the hybridization buffer. Pair files lost due to a computer crash.
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
