Kefir drink
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA822906 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Morus alba L. Raw protein sequence reads and sequence
2024-02-08 | PXD049451 |
Project description:Analysis of microbial community composition in arctic tundra and boreal forest soils using serial analysis of ribosomal sequence tags (SARST). Keywords: other
2004-01-12 | GSE949 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Purpose: The goal of this study is to compare endothelial small RNA transcriptome to identify the target of OASL under basal or stimulated conditions by utilizing miRNA-seq. Methods: Endothelial miRNA profilies of siCTL or siOASL transfected HUVECs were generated by illumina sequencing method, in duplicate. After sequencing, the raw sequence reads are filtered based on quality. The adapter sequences are also trimmed off the raw sequence reads. rRNA removed reads are sequentially aligned to reference genome (GRCh38) and miRNA prediction is performed by miRDeep2. Results: We identified known miRNA in species (miRDeep2) in the HUVECs transfected with siCTL or siOASL. The expression profile of mature miRNA is used to analyze differentially expressed miRNA(DE miRNA). Conclusions: Our study represents the first analysis of endothelial miRNA profiles affected by OASL knockdown with biologic replicates.
2022-09-06 | GSE186354 | GEO
Project description:A cDNA library was constructed by Novogene (CA, USA) using a Small RNA Sample Pre Kit, and Illumina sequencing was conducted according to company workflow, using 20 million reads. Raw data were filtered for quality as determined by reads with a quality score > 5, reads containing N < 10%, no 5' primer contaminants, and reads with a 3' primer and insert tag. The 3' primer sequence was trimmed and reads with a poly A/T/G/C were removed
2021-07-21 | GSE180131 | GEO
Project description:Microbial composition of Kefir- UDI strain using shotgun and amplicons metagenomics
| PRJEB40661 | ENA
Project description:An increasing body of evidence suggests an important role of the human microbiome in health and disease. We propose a ‘lost and found’ pipeline, which examines high quality unmapped sequence reads for microbial taxonomic classification. Using this pipeline, we are able to detect bacterial and archaeal phyla in blood using RNA sequencing (RNA-Seq) data. Careful analyses, including the use of positive and negative control datasets, suggest that these detected phyla represent true microbial communities in whole blood and are not due to contaminants. We applied our pipeline to study the composition of microbial communities present in blood across 192 individuals from four subject groups: schizophrenia (n=48), amyotrophic lateral sclerosis (n=47), bipolar disorder (n=48) and healthy controls (n=49). We observe a significantly increased microbial diversity in schizophrenia compared to the three other groups and replicate this finding in an independent schizophrenia case-control study. Our results demonstrate the potential use of total RNA to study microbes that inhabit the human body.
2016-05-25 | GSE80974 | GEO
Project description:The study investigated the impact of environment on the composition of the gut microbiota and mucosal immune development and function at gut surfaces in early and adult life. Piglets of similar genotype were reared in indoor and outdoor environments and in an experimental isolator facility. Mucosa-adherent microbial diversity in the pig ileum was characterized by sequence analysis of 16S rRNA gene libraries. Host-specific gene responses in gut ileal tissues to differences in microbial composition were investigated using Affymetrix microarray technology and Real-time PCR.
2009-12-01 | GSE15256 | GEO
Project description:To effectively monitor microbial populations in acidic environments and bioleaching systems, a comprehensive 50-mer-based oligonucleotide microarray was developed based on most of the known genes associated with the acidophiles. This array contained 1,072 probes in which there were 571 related to 16S rRNA and 501 related to functional genes. Acid mine drainage (AMD) presents numerous problems to the aquatic life and surrounding ecosystems. However, little is known about the geographic distribution, diversity, composition, structure and function of AMD microbial communities. In this study, we analyzed the geographic distribution of AMD microbial communities from twenty sites using restriction fragment length polymorphism (RFLP) analysis of 16S rRNA genes, and the results showed that AMD microbial communities were geographically distributed and had high variations among different sites. Then an AMD-specific microarray was used to further analyze nine AMD microbial communities, and showed that those nine AMD microbial communities had high variations measured by the number of detected genes, overlapping genes between samples, unique genes, and diversity indices. Statistical analyses indicated that the concentrations of Fe, S, Ca, Mg, Zn, Cu and pH had strong impacts on both phylogenetic and functional diversity, composition, and structure of AMD microbial communities. This study provides insights into our understanding of the geographic distribution, diversity, composition, structure and functional potential of AMD microbial communities and key environmental factors shaping them. This study investigated the geographic distribution of Acid Mine Drainages microbial communities using a 16S rRNA gene-based RFLP method and the diversity, composition and structure of AMD microbial communities phylogenetically and functionally using an AMD-specific microarray which contained 1,072 probes ( 571 related to 16S rRNA and 501 related to functional genes). The functional genes in the microarray were involved in carbon metabolism (158), nitrogen metabolism (72), sulfur metabolism (39), iron metabolism (68), DNA replication and repair (97), metal-resistance (27), membrane-relate gene (16), transposon (13) and IST sequence (11).
2011-03-08 | E-GEOD-27542 | biostudies-arrayexpress