Project description:We investigated the effect of feeding mice a Total Western Diet formulated using the 50th percentile daily intake levels for macro and micronutrients from the National Health and Nutrition Examination Survey (NHANES) with 0, 2, 5, or 10% added raw potato starch on the cecal microbiome (16S) and cecum, proximal and distal colon gene expression by RNASeq analysis.
Project description:We investigated the effect of feeding mice a Total Western Diet formulated using the 50th percentile daily intake levels for macro and micronutrients from the National Health and Nutrition Examination Survey (NHANES) with 0, 2, 5, or 10% added raw potato starch on the cecal microbiome (16S) and cecum, proximal and distal colon gene expression by RNASeq analysis.
Project description:We investigated the effect of feeding mice a Total Western Diet formulated using the 50th percentile daily intake levels for macro and micronutrients from the National Health and Nutrition Examination Survey (NHANES) with 0, 2, 5, or 10% added raw potato starch on the cecal microbiome (16S) and cecum, proximal and distal colon gene expression by RNASeq analysis.
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
Project description:16S amplicon pool analyses of the four gut sections of the wood-feeding beetle, Odontotaenius disjunctus The beetle is purely wood feeding, and we aim to first characterize the community that exist within the gut sections
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:16S amplicon pool analyses of the four gut sections of the wood-feeding beetle, Odontotaenius disjunctus The beetle is purely wood feeding, and we aim to first characterize the community that exist within the gut sections 4 beetles, four gut sections per beetle, one PhyloChip per gut section, total = 16 chips
